Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BUB3 cdna clone

BUB3 cDNA Clone

Gene Names
BUB3; BUB3L; hBUB3
Synonyms
BUB3; BUB3 cDNA Clone; BUB3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccggttctaacgagttcaagctgaaccagccacccgaggatggcatctcctccgtgaagttcagccccaacacctcccagttcctgcttgtctcctcctgggacacgtccgtgcgtctctacgatgtgccggccaactccatgcggctcaagtaccagcacaccggcgccgtcctggactgcgccttctacgatccaacgcatgcctggagtggaggactagatcatcaattgaaaatgcatgatttgaacactgatcaagaaaatcttgttgggacccatgatgcccctatcagatgtgttgaatactgtccagaagtgaatgtgatggtcactggaagttgggatcagacagttaaactgtgggatcccagaactccttgtaatgctgggaccttctctcagcctgaaaaggtatataccctctcagtgtctggagaccggctgattgtgggaacagcaggccgcagagtgttggtgtgggacttacggaacatgggttacgtgcagcagcgcagggagtccagcctgaaataccagactcgctgcatacgagcgtttccaaacaagcagggttatgtattaagctctattgaaggccgagtggcagttgagtatttggacccaagccctgaggtacagaagaagaagtatgccttcaaatgtcacagactaaaagaaaataatattgagcagatttacccagtcaatgccatttcttttcacaatatccacaatacatttgccacaggtggttctgatggctttgtaaatatttgggatccatttaacaaaaagcgactgtgccaattccatcggtaccccacgagcatcgcatcacttgccttcagtaatgatgggactacgcttgcaatagcgtcatcatatatgtatgaaatggatgacacagaacatcctgaagatggtatcttcattcgccaagtgacagatgcagaaacaaaacccaagtcaccatgtacttga
Sequence Length
987
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,955 Da
NCBI Official Full Name
Homo sapiens budding uninhibited by benzimidazoles 3 homolog (yeast), mRNA
NCBI Official Synonym Full Names
BUB3, mitotic checkpoint protein
NCBI Official Symbol
BUB3
NCBI Official Synonym Symbols
BUB3L; hBUB3
NCBI Protein Information
mitotic checkpoint protein BUB3
UniProt Protein Name
Mitotic checkpoint protein BUB3
UniProt Gene Name
BUB3
UniProt Entry Name
BUB3_HUMAN

NCBI Description

This gene encodes a protein involved in spindle checkpoint function. The encoded protein contains four WD repeat domains and has sequence similarity with the yeast BUB3 protein. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

BUB3: Has a dual function in spindle-assembly checkpoint signaling and in promoting the establishment of correct kinetochore-microtubule (K-MT) attachments. Promotes the formation of stable end-on bipolar attachments. Necessary for kinetochore localization of BUB1. Regulates chromosome segregation during oocyte meiosis. The BUB1/BUB3 complex plays a role in the inhibition of anaphase-promoting complex or cyclosome (APC/C) when spindle-assembly checkpoint is activated and inhibits the ubiquitin ligase activity of APC/C by phosphorylating its activator CDC20. This complex can also phosphorylate MAD1L1. Interacts with BUB1 and BUBR1. The BUB1/BUB3 complex interacts with MAD1L1. Belongs to the WD repeat BUB3 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 10q26

Cellular Component: cytosol; kinetochore; nucleoplasm

Molecular Function: protein binding; ubiquitin binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; attachment of spindle microtubules to kinetochore; mitotic cell cycle spindle assembly checkpoint; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; sister chromatid cohesion

Research Articles on BUB3

Similar Products

Product Notes

The BUB3 bub3 (Catalog #AAA1267126) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccggtt ctaacgagtt caagctgaac cagccacccg aggatggcat ctcctccgtg aagttcagcc ccaacacctc ccagttcctg cttgtctcct cctgggacac gtccgtgcgt ctctacgatg tgccggccaa ctccatgcgg ctcaagtacc agcacaccgg cgccgtcctg gactgcgcct tctacgatcc aacgcatgcc tggagtggag gactagatca tcaattgaaa atgcatgatt tgaacactga tcaagaaaat cttgttggga cccatgatgc ccctatcaga tgtgttgaat actgtccaga agtgaatgtg atggtcactg gaagttggga tcagacagtt aaactgtggg atcccagaac tccttgtaat gctgggacct tctctcagcc tgaaaaggta tataccctct cagtgtctgg agaccggctg attgtgggaa cagcaggccg cagagtgttg gtgtgggact tacggaacat gggttacgtg cagcagcgca gggagtccag cctgaaatac cagactcgct gcatacgagc gtttccaaac aagcagggtt atgtattaag ctctattgaa ggccgagtgg cagttgagta tttggaccca agccctgagg tacagaagaa gaagtatgcc ttcaaatgtc acagactaaa agaaaataat attgagcaga tttacccagt caatgccatt tcttttcaca atatccacaa tacatttgcc acaggtggtt ctgatggctt tgtaaatatt tgggatccat ttaacaaaaa gcgactgtgc caattccatc ggtaccccac gagcatcgca tcacttgcct tcagtaatga tgggactacg cttgcaatag cgtcatcata tatgtatgaa atggatgaca cagaacatcc tgaagatggt atcttcattc gccaagtgac agatgcagaa acaaaaccca agtcaccatg tacttga. It is sometimes possible for the material contained within the vial of "BUB3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.