Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ENO1 cdna clone

ENO1 cDNA Clone

Gene Names
ENO1; NNE; PPH; MPB1; ENO1L1; HEL-S-17
Synonyms
ENO1; ENO1 cDNA Clone; ENO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctattctcaagatccatgccagggagatctttgactctcgcgggaatcccactgttgaggttgatctcttcacctcaaaaggtctcttcagagctgctgtgcccagtggtgcttcaactggtatctatgaggccctagagctccgggacaatgataagactcgctatatggggaagggtgtctcaaaggctgttgagcacatcaataaaactattgcgcctgccctggttagcaagaaactgaacgtcacagaacaagagaagattgacaaactgatgatcgagatggatggaacagaaaataaatctaagtttggtgcgaacgccattctgggggtgtcccttgccgtctgcaaagctggtgccgttgagaagggggtccccctgtaccgccacatcgctgacttggctggcaactctgaagtcatcctgccagtcccggcgttcaatgtcatcaatggcggttctcatgctggcaacaagctggccatgcaggagttcatgatcctcccagtcggtgcagcaaacttcagggaagccatgcgcattggagcagaggtttaccacaacctgaagaatgtcatcaaggagaaatatgggaaagatgccaccaatgtgggggatgaaggcgggtttgctcccaacatcctggagaataaagaaggcctggagctgctgaagactgctattgggaaagctggctacactgataaggtggtcatcggcatggacgtagcggcctccgagttcttcaggtctgggaagtatgacctggacttcaagtctcccgatgaccccagcaggtacatctcgcctgaccagctggctgacctgtacaagtccttcatcaaggactacccagtggtgtctatcgaagatccctttgaccaggatgactggggagcttggcagaagttcacagccagtgcaggaatccaggtagtgggggatgatctcacagtgaccaacccaaagaggatcgccaaggccgtgaacgagaagtcctgcaactgcctcctgctcaaagtcaaccagattggctccgtgaccgagtctcttcaggcgtgcaagctggcccaggccaatggttggggcgtcatggtgtctcatcgttcgggggagactgaagataccttcatcgctgacctggttgtggggctgtgcactgggcagatcaagactggtgccccttgccgatctgagcgcttggccaagtacaaccagctcctcagaattgaagaggagctgggcagcaaggctaagtttgccggcaggaacttcagaaaccccttggccaagtaa
Sequence Length
1305
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,928 Da
NCBI Official Full Name
Homo sapiens enolase 1, (alpha), mRNA
NCBI Official Synonym Full Names
enolase 1
NCBI Official Symbol
ENO1
NCBI Official Synonym Symbols
NNE; PPH; MPB1; ENO1L1; HEL-S-17
NCBI Protein Information
alpha-enolase; c-myc promoter-binding protein-1
UniProt Protein Name
Alpha-enolase
Protein Family
UniProt Gene Name
ENO1
UniProt Synonym Gene Names
ENO1L1; MBPB1; MPB1; NNE
UniProt Entry Name
ENOA_HUMAN

NCBI Description

This gene encodes alpha-enolase, one of three enolase isoenzymes found in mammals. Each isoenzyme is a homodimer composed of 2 alpha, 2 gamma, or 2 beta subunits, and functions as a glycolytic enzyme. Alpha-enolase in addition, functions as a structural lens protein (tau-crystallin) in the monomeric form. Alternative splicing of this gene results in a shorter isoform that has been shown to bind to the c-myc promoter and function as a tumor suppressor. Several pseudogenes have been identified, including one on the long arm of chromosome 1. Alpha-enolase has also been identified as an autoantigen in Hashimoto encephalopathy. [provided by RefSeq, Jan 2011]

Uniprot Description

ENO1: an abundant cytoplasmic enzyme with 2-phospho-D-glycerate hydro-lyase activity. A target of excess protein nitration in Alzheimer disease (AD) brain. Tau-crystallin, a structural lens protein, is produced from an alternative translation start in the enolase gene.

Protein type: Lyase; Carbohydrate Metabolism - glycolysis and gluconeogenesis; EC 4.2.1.11; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 1p36.2

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; extracellular space; membrane; nucleus

Molecular Function: GTPase binding; phosphopyruvate hydratase activity; protein binding; transcription corepressor activity; transcription factor activity

Biological Process: gluconeogenesis; negative regulation of cell growth; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; response to virus

Research Articles on ENO1

Similar Products

Product Notes

The ENO1 eno1 (Catalog #AAA1267106) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctattc tcaagatcca tgccagggag atctttgact ctcgcgggaa tcccactgtt gaggttgatc tcttcacctc aaaaggtctc ttcagagctg ctgtgcccag tggtgcttca actggtatct atgaggccct agagctccgg gacaatgata agactcgcta tatggggaag ggtgtctcaa aggctgttga gcacatcaat aaaactattg cgcctgccct ggttagcaag aaactgaacg tcacagaaca agagaagatt gacaaactga tgatcgagat ggatggaaca gaaaataaat ctaagtttgg tgcgaacgcc attctggggg tgtcccttgc cgtctgcaaa gctggtgccg ttgagaaggg ggtccccctg taccgccaca tcgctgactt ggctggcaac tctgaagtca tcctgccagt cccggcgttc aatgtcatca atggcggttc tcatgctggc aacaagctgg ccatgcagga gttcatgatc ctcccagtcg gtgcagcaaa cttcagggaa gccatgcgca ttggagcaga ggtttaccac aacctgaaga atgtcatcaa ggagaaatat gggaaagatg ccaccaatgt gggggatgaa ggcgggtttg ctcccaacat cctggagaat aaagaaggcc tggagctgct gaagactgct attgggaaag ctggctacac tgataaggtg gtcatcggca tggacgtagc ggcctccgag ttcttcaggt ctgggaagta tgacctggac ttcaagtctc ccgatgaccc cagcaggtac atctcgcctg accagctggc tgacctgtac aagtccttca tcaaggacta cccagtggtg tctatcgaag atccctttga ccaggatgac tggggagctt ggcagaagtt cacagccagt gcaggaatcc aggtagtggg ggatgatctc acagtgacca acccaaagag gatcgccaag gccgtgaacg agaagtcctg caactgcctc ctgctcaaag tcaaccagat tggctccgtg accgagtctc ttcaggcgtg caagctggcc caggccaatg gttggggcgt catggtgtct catcgttcgg gggagactga agataccttc atcgctgacc tggttgtggg gctgtgcact gggcagatca agactggtgc cccttgccga tctgagcgct tggccaagta caaccagctc ctcagaattg aagaggagct gggcagcaag gctaagtttg ccggcaggaa cttcagaaac cccttggcca agtaa. It is sometimes possible for the material contained within the vial of "ENO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.