Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GTPBP8 cdna clone

GTPBP8 cDNA Clone

Gene Names
GTPBP8; HSPC135
Synonyms
GTPBP8; GTPBP8 cDNA Clone; GTPBP8 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgcccgggctgcggctgggagcgggaagactctttgaaatgcctgcggtgctagagcgactgagccgctataatagcacgtcccaagcttttgctgaggtgctgcggctgccgaagcagcagctgaggaagctgctgtacccgctgcaggaagtagagcggttcctcgccccctacgggaggcaagaccttcacctgcgtatctttgacccaagcccggaggacatagccagggcggacaacatcttcacggccactgaacggaaccgcatcgactacgtcagctccgccgtccgtatcgaccacgccccggaccttccgcggccagaggtgtgttttataggcagaagcaatgttggaaaatcatctctaatcaaggctttattttcactggcccctgaggttgaagtcagagtctccaaaaaaccaggacacacaaagaaaatgaattttttcaaagttggaaaacattttacagctggtggacatgccaggttatggctttag
Sequence Length
513
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,848 Da
NCBI Official Full Name
Homo sapiens GTP-binding protein 8 (putative), mRNA
NCBI Official Synonym Full Names
GTP binding protein 8 (putative)
NCBI Official Symbol
GTPBP8
NCBI Official Synonym Symbols
HSPC135
NCBI Protein Information
GTP-binding protein 8
UniProt Protein Name
GTP-binding protein 8
Protein Family
UniProt Gene Name
GTPBP8
UniProt Entry Name
GTPB8_HUMAN

Uniprot Description

GTPBP8: Belongs to the EngB family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 3q13.2

Cellular Component: mitochondrion

Molecular Function: GTP binding; GTPase activity

Research Articles on GTPBP8

Similar Products

Product Notes

The GTPBP8 gtpbp8 (Catalog #AAA1267070) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc ccgggctgcg gctgggagcg ggaagactct ttgaaatgcc tgcggtgcta gagcgactga gccgctataa tagcacgtcc caagcttttg ctgaggtgct gcggctgccg aagcagcagc tgaggaagct gctgtacccg ctgcaggaag tagagcggtt cctcgccccc tacgggaggc aagaccttca cctgcgtatc tttgacccaa gcccggagga catagccagg gcggacaaca tcttcacggc cactgaacgg aaccgcatcg actacgtcag ctccgccgtc cgtatcgacc acgccccgga ccttccgcgg ccagaggtgt gttttatagg cagaagcaat gttggaaaat catctctaat caaggcttta ttttcactgg cccctgaggt tgaagtcaga gtctccaaaa aaccaggaca cacaaagaaa atgaattttt tcaaagttgg aaaacatttt acagctggtg gacatgccag gttatggctt tag. It is sometimes possible for the material contained within the vial of "GTPBP8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.