NGEF cdna clone
NGEF cDNA Clone
Gene Names
NGEF; EPHEXIN; ARHGEF27
Synonyms
NGEF; NGEF cDNA Clone; NGEF cdna clone
Sequence
atggagaccagggaatctgaagatttggaaaagacccggaggaaatcagcaagtgatcaatggaacactgataatgaaccagccaaggtgaaacctgagttactcccagaaaaagaggagacttctcaagctgaccaggatatccaagacaaagagcctcattgccacatcccaattaagagaaattccatcttcaatcgctccataagacgcaaaagcaaagccaaggccagagacaaccccgaacggaacgccagctgcctggcagattcacaggacaatggaaaatctgtaaatgagcccctgaccttgaatatcccctggagcagaacgcctccttgcagaacagcaatgcagacagacccaggagcccaggaaatgagtgagtcgtcctccaccccgggaaatggggccacgcccgaggagtggccggccctggccgacagccccaccacgctcaccgaggccctgcggatgatccaccccattcccgccgactcctggagaaacctcattgaacaaatagggctcctgtatcaggaataccgagataaatcgactctccaagaaatcgaaaccaggaggcaacaggatgcagaaatagaagacaataccaatgggtccccggccagtgaggacaccccggaggaggaagaagaagaggaggaggaggaggagccggccagcccaccagagaggaagactctgccccagatctgcctgctcagtaacccccactcaaggttcaacctctggcaggatcttcccgagatccggagcagcggggtgcttgagatcctacagcctgaggagattaagctgcaggaggccatgttcgagctggtcacttccgaggcgtcctactacaagagtctgaacctgctcgtgtcccacttcatggagaacgagcggataaggaagatcctgcacccgtccgaggcgcacatcctcttctccaacgtcctggacgtgctggctgtcagtgagcggttcctcctggagctggagcaccggatggaggagaacatcgtcatctctgacgtgtgtgacatcgtgtaccgttatgcggctgaccacttctctgtctacatcacctacgtcagcaatcagacctaccaggagcggacctataagcagctgctccaggagaaggcagctttccgggagctgatcgcgcagctagagctcgaccccaagtgcagggggctgcccttctcctccttcctcatcctgcctttccagaggatcacacgcctcaagctgttggtccagaacatcctgaagagggtagaagagaggtctgagcgggagtgcactgctttggatgctcacaaggagctggaaatggtggtgaaggcatgcaacgagggcgtcaggaaaatgagccgcacggaacagatgatcagcattcagaagaagatggagttcaagatcaagtcggtgcccatcatctcccactcccgctggctgctgaagcagggtgagctgcagcagatgtcaggccccaagacctcccggaccctgaggaccaagaagctcttccacgaaatttacctcttcctgttcaacgacctgctggtgatctgccggcagattccaggagacaagtaccaggtatttgactcagctccgcggggactgctgcgtgtggaggagctggaggaccagggccagacgctggccaacgtgttcatcctgcggctgctggagaacgcagatgaccgggaggccacctacatgctaaaggcgtcctctcagagtgagatgaagcgttggatgacctcactggcccccaacaggaggaccaagtttgtttcgttcacatcccggctgctggactgcccccaggtccagtgcgtgcacccatacgtggctcagcagccagacgagctgacgctggagctcgccgacatcctcaacatcctggacaagactgacgacgggtggatctttggcgagcgtctgcacgaccaggagagaggctggttccccagctccatgactgaggagatcttgaatcccaagatccggtcccagaacctcaaggaatgtttccgtgtccacaagatggatgaccctcagcgcagccagaacaaggaccgcaggaagctgggcagccggaatcggcaatga
Sequence Length
2133
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
71,387 Da
NCBI Official Full Name
Homo sapiens neuronal guanine nucleotide exchange factor, mRNA
NCBI Official Synonym Full Names
neuronal guanine nucleotide exchange factor
NCBI Official Symbol
NGEF
NCBI Official Synonym Symbols
EPHEXIN; ARHGEF27
NCBI Protein Information
ephexin-1
UniProt Protein Name
Ephexin-1
Protein Family
UniProt Gene Name
NGEF
UniProt Entry Name
NGEF_HUMAN
Uniprot Description
ephexin-1: Acts as a guanine nucleotide exchange factor (GEF) which differentially activates the GTPases RHOA, RAC1 and CDC42. Plays a role in axon guidance regulating ephrin-induced growth cone collapse and dendritic spine morphogenesis. Upon activation by ephrin through EPHA4, the GEF activity switches toward RHOA resulting in its activation. Activated RHOA promotes cone retraction at the expense of RAC1- and CDC42-stimulated growth cone extension. Interacts with CDK5R1 and EPHA4; activated by EPHA4 through the CDK5 kinase. Highly expressed in brain specifically in caudate nucleus and to a lower extent in amygdala and hippocampus. Also detected in lung. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: GEFs, Rac/Rho; GEFs
Chromosomal Location of Human Ortholog: 2q37
Cellular Component: cytosol
Molecular Function: guanyl-nucleotide exchange factor activity; Rho guanyl-nucleotide exchange factor activity
Biological Process: ephrin receptor signaling pathway; positive regulation of apoptosis; regulation of GTPase activity; regulation of small GTPase mediated signal transduction
Research Articles on NGEF
Similar Products
Product Notes
The NGEF ngef (Catalog #AAA1267066) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacca gggaatctga agatttggaa aagacccgga ggaaatcagc aagtgatcaa tggaacactg ataatgaacc agccaaggtg aaacctgagt tactcccaga aaaagaggag acttctcaag ctgaccagga tatccaagac aaagagcctc attgccacat cccaattaag agaaattcca tcttcaatcg ctccataaga cgcaaaagca aagccaaggc cagagacaac cccgaacgga acgccagctg cctggcagat tcacaggaca atggaaaatc tgtaaatgag cccctgacct tgaatatccc ctggagcaga acgcctcctt gcagaacagc aatgcagaca gacccaggag cccaggaaat gagtgagtcg tcctccaccc cgggaaatgg ggccacgccc gaggagtggc cggccctggc cgacagcccc accacgctca ccgaggccct gcggatgatc caccccattc ccgccgactc ctggagaaac ctcattgaac aaatagggct cctgtatcag gaataccgag ataaatcgac tctccaagaa atcgaaacca ggaggcaaca ggatgcagaa atagaagaca ataccaatgg gtccccggcc agtgaggaca ccccggagga ggaagaagaa gaggaggagg aggaggagcc ggccagccca ccagagagga agactctgcc ccagatctgc ctgctcagta acccccactc aaggttcaac ctctggcagg atcttcccga gatccggagc agcggggtgc ttgagatcct acagcctgag gagattaagc tgcaggaggc catgttcgag ctggtcactt ccgaggcgtc ctactacaag agtctgaacc tgctcgtgtc ccacttcatg gagaacgagc ggataaggaa gatcctgcac ccgtccgagg cgcacatcct cttctccaac gtcctggacg tgctggctgt cagtgagcgg ttcctcctgg agctggagca ccggatggag gagaacatcg tcatctctga cgtgtgtgac atcgtgtacc gttatgcggc tgaccacttc tctgtctaca tcacctacgt cagcaatcag acctaccagg agcggaccta taagcagctg ctccaggaga aggcagcttt ccgggagctg atcgcgcagc tagagctcga ccccaagtgc agggggctgc ccttctcctc cttcctcatc ctgcctttcc agaggatcac acgcctcaag ctgttggtcc agaacatcct gaagagggta gaagagaggt ctgagcggga gtgcactgct ttggatgctc acaaggagct ggaaatggtg gtgaaggcat gcaacgaggg cgtcaggaaa atgagccgca cggaacagat gatcagcatt cagaagaaga tggagttcaa gatcaagtcg gtgcccatca tctcccactc ccgctggctg ctgaagcagg gtgagctgca gcagatgtca ggccccaaga cctcccggac cctgaggacc aagaagctct tccacgaaat ttacctcttc ctgttcaacg acctgctggt gatctgccgg cagattccag gagacaagta ccaggtattt gactcagctc cgcggggact gctgcgtgtg gaggagctgg aggaccaggg ccagacgctg gccaacgtgt tcatcctgcg gctgctggag aacgcagatg accgggaggc cacctacatg ctaaaggcgt cctctcagag tgagatgaag cgttggatga cctcactggc ccccaacagg aggaccaagt ttgtttcgtt cacatcccgg ctgctggact gcccccaggt ccagtgcgtg cacccatacg tggctcagca gccagacgag ctgacgctgg agctcgccga catcctcaac atcctggaca agactgacga cgggtggatc tttggcgagc gtctgcacga ccaggagaga ggctggttcc ccagctccat gactgaggag atcttgaatc ccaagatccg gtcccagaac ctcaaggaat gtttccgtgt ccacaagatg gatgaccctc agcgcagcca gaacaaggac cgcaggaagc tgggcagccg gaatcggcaa tga. It is sometimes possible for the material contained within the vial of "NGEF, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
