Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UFC1 cdna clone

UFC1 cDNA Clone

Gene Names
UFC1; HSPC155
Synonyms
UFC1; UFC1 cDNA Clone; UFC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggatgaagccacgcgacgtgttgtgtctgagatcccggtgctgaagactaacgccggaccccgagatcgtgagttgtgggtgcagcgactgaaggaggaatatcagtcccttatccggtatgtggagaacaacaagaatgctgacaacgattggttccgactggagtccaacaaggaaggaactcggtggtttggaaaatgctggtatatccatgacctcctgaaatatgagtttgacatcgagtttgacattcctatcacatgtcctactactgccccagaaattgcagttcctgagctggatggaaagacagcaaagatgtacaggggtggcaaaatatgcctgacggatcatttcaaacctttgtgggccaggaatgtgcccaaatttggactagctcatctcatggctctggggctgggtccatggctggcagtggaaatccctgatctgattcagaagggcgtcatccaacacaaagagaaatgcaaccaatga
Sequence Length
504
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,458 Da
NCBI Official Full Name
Homo sapiens ubiquitin-fold modifier conjugating enzyme 1, mRNA
NCBI Official Synonym Full Names
ubiquitin-fold modifier conjugating enzyme 1
NCBI Official Symbol
UFC1
NCBI Official Synonym Symbols
HSPC155
NCBI Protein Information
ubiquitin-fold modifier-conjugating enzyme 1
UniProt Protein Name
Ubiquitin-fold modifier-conjugating enzyme 1
UniProt Gene Name
UFC1
UniProt Synonym Gene Names
Ufm1-conjugating enzyme 1
UniProt Entry Name
UFC1_HUMAN

NCBI Description

UFC1 is an E2-like conjugating enzyme for ubiquitin-fold modifier-1 (UFM1; MIM 610553) (Komatsu et al., 2004 [PubMed 15071506]).[supplied by OMIM, Mar 2008]

Uniprot Description

UFC1: E2-like enzyme which forms an intermediate with UFM1 via a thioester linkage. Belongs to the ubiquitin-conjugating enzyme family. UFC1 subfamily.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 1q23.3

Molecular Function: protein binding

Research Articles on UFC1

Similar Products

Product Notes

The UFC1 ufc1 (Catalog #AAA1267044) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggatg aagccacgcg acgtgttgtg tctgagatcc cggtgctgaa gactaacgcc ggaccccgag atcgtgagtt gtgggtgcag cgactgaagg aggaatatca gtcccttatc cggtatgtgg agaacaacaa gaatgctgac aacgattggt tccgactgga gtccaacaag gaaggaactc ggtggtttgg aaaatgctgg tatatccatg acctcctgaa atatgagttt gacatcgagt ttgacattcc tatcacatgt cctactactg ccccagaaat tgcagttcct gagctggatg gaaagacagc aaagatgtac aggggtggca aaatatgcct gacggatcat ttcaaacctt tgtgggccag gaatgtgccc aaatttggac tagctcatct catggctctg gggctgggtc catggctggc agtggaaatc cctgatctga ttcagaaggg cgtcatccaa cacaaagaga aatgcaacca atga. It is sometimes possible for the material contained within the vial of "UFC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.