Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHMP4C cdna clone

CHMP4C cDNA Clone

Gene Names
CHMP4C; Shax3; SNF7-3; VPS32C
Synonyms
CHMP4C; CHMP4C cDNA Clone; CHMP4C cdna clone
Ordering
For Research Use Only!
Sequence
atgagcaagttgggcaagttctttaaagggggcggctcttctaagagccgagccgctcccagtccccaggaggccctggtccgacttcgggagactgaggagatgctgggcaagaaacaagagtacctggaaaatcgaatccagagagaaatcgccctggccaagaagcacggcacgcagaataagcgagctgcattacaggcactaaagagaaagaagaggttcgagaaacagctcactcagattgatggcacactttctaccattgagttccagagagaagccctggagaactcacacaccaacactgaggtgttgaggaacatgggctttgcagcaaaagcgatgaaatctgttcatgaaaacatggatctgaacaaaatagatgatttgatgcaagagatcacagagcaacaggatatcgcccaagaaatctcagaagcattttctcaacgggttggctttggtgatgactttgatgaggatgagttgatggcagaacttgaagaattggaacaggaggaattaaataagaagatgacaaatatccgccttccaaatgtgccttcctcttctctcccagcacagccaaatagaaaaccaggcatgtcgtccactgcacgtcgatcccgagcagcatcttcccagagggcagaagaagaggatgatgatatcaaacaattggcagcttgggctacctaa
Sequence Length
702
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,411 Da
NCBI Official Full Name
Homo sapiens chromatin modifying protein 4C, mRNA
NCBI Official Synonym Full Names
charged multivesicular body protein 4C
NCBI Official Symbol
CHMP4C
NCBI Official Synonym Symbols
Shax3; SNF7-3; VPS32C
NCBI Protein Information
charged multivesicular body protein 4c
UniProt Protein Name
Charged multivesicular body protein 4c
UniProt Gene Name
CHMP4C
UniProt Synonym Gene Names
SHAX3; CHMP4c; hSnf7-3; Vps32-3; hVps32-3
UniProt Entry Name
CHM4C_HUMAN

NCBI Description

CHMP4C belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008]

Uniprot Description

CHMP4C: component of the ESCRT-III complex, which is required for multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. The MVB pathway mediates delivery of transmembrane proteins into the lumen of the lysosome for degradation. The ESCRT-III complex is probably involved in the concentration of MVB cargo. In the ESCRT-III complex, it probably serves as an acceptor for ESCRT-I complex on endosomal membranes. In case of infection, the HIV-1 virus takes advantage of the ESCRT-III complex for budding and exocytic cargos of viral proteins, via the association of CHMP4 proteins with PDCD6IP/AIP1, a protein directly recruited by HIV-1 p6 protein that functions at sites of viral Gag assembly and budding.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 8q21.13

Cellular Component: cytosol; midbody

Molecular Function: protein binding; protein homodimerization activity

Biological Process: abscission; autophagy; cell separation during cytokinesis; endosome transport; mitotic metaphase plate congression; negative regulation of cytokinesis; nuclear organization and biogenesis; regulation of viral reproduction; viral infectious cycle

Research Articles on CHMP4C

Similar Products

Product Notes

The CHMP4C chmp4c (Catalog #AAA1267025) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcaagt tgggcaagtt ctttaaaggg ggcggctctt ctaagagccg agccgctccc agtccccagg aggccctggt ccgacttcgg gagactgagg agatgctggg caagaaacaa gagtacctgg aaaatcgaat ccagagagaa atcgccctgg ccaagaagca cggcacgcag aataagcgag ctgcattaca ggcactaaag agaaagaaga ggttcgagaa acagctcact cagattgatg gcacactttc taccattgag ttccagagag aagccctgga gaactcacac accaacactg aggtgttgag gaacatgggc tttgcagcaa aagcgatgaa atctgttcat gaaaacatgg atctgaacaa aatagatgat ttgatgcaag agatcacaga gcaacaggat atcgcccaag aaatctcaga agcattttct caacgggttg gctttggtga tgactttgat gaggatgagt tgatggcaga acttgaagaa ttggaacagg aggaattaaa taagaagatg acaaatatcc gccttccaaa tgtgccttcc tcttctctcc cagcacagcc aaatagaaaa ccaggcatgt cgtccactgc acgtcgatcc cgagcagcat cttcccagag ggcagaagaa gaggatgatg atatcaaaca attggcagct tgggctacct aa. It is sometimes possible for the material contained within the vial of "CHMP4C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.