Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CKB cdna clone

CKB cDNA Clone

Gene Names
CKB; BCK; B-CK; CKBB; HEL-211; HEL-S-29
Synonyms
CKB; CKB cDNA Clone; CKB cdna clone
Ordering
For Research Use Only!
Sequence
atgcccttctccaacagccacaacgcactgaagctgcgcttcccggccgaggacgagttccccgacctgagcgcccacaacaaccacatggccaaggtgctgacccccgagctgtacgcggagctgcgcgccaagagcacgccgagcggcttcacgctggacgacgtcatccagacaggcgtggacaacccgggccatccgtacatcatgaccgtgggctgcgtggcgggcgacgaggagtcctacgaagtgttcaaggatctcttcgaccccatcatcgaggaccggcacggcggctacaagcccagcgatgagcacaagaccgacctcaaccccgacaacctgcagggcggcgacgacctggaccccaactacgtgctgagctcgcgggtgcgcacgggccgcagcatccgtggcttctgcctccccccgcactgcagccgcggggagcgccgagccatcgagaagctcgcggtggaagccctgtccagcctggacggcgacctggcgggccgatactacgcgctcaagagcatgacggaggcggagcagcagcagctcatcgacgaccacttcctcttcgacaagcccgtgtcgcccctgctgctggcctcgggcatggcccgcgactggcccgacgcccgcggtatctggcacaatgacaataagaccttcctggtgtgggtcaacgaggaggaccacctgcgggtcatctccatgcagaaggggggcaacatgaaggaggtgttcacccgcttctgcaccggcctcacccagattgaaactctcttcaagtctaaggactatgagttcatgtggaaccctcacctgggctacatcctcacctgcccatccaacctgggcaccgggctgcgggcaggtgtgcatatcaagctgcccaacctgggcaagcatgagaagttctcggaggtgcttaagcggctgcgacttcagaagcgaggcacaggcggtgtggacacggctgcggtgggcggggtcttcgacgtctccaacgctgaccgcctgggcttctcagaggtggagctggtgcagatggtggtggacggagtgaagctgctcatcgagatggaacagcggctggagcagggccaggccatcgacgacctcatgcctgcccagaaatga
Sequence Length
1146
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,644 Da
NCBI Official Full Name
Homo sapiens creatine kinase, brain, mRNA
NCBI Official Synonym Full Names
creatine kinase B
NCBI Official Symbol
CKB
NCBI Official Synonym Symbols
BCK; B-CK; CKBB; HEL-211; HEL-S-29
NCBI Protein Information
creatine kinase B-type
UniProt Protein Name
Creatine kinase B-type
Protein Family
UniProt Gene Name
CKB
UniProt Synonym Gene Names
CKBB
UniProt Entry Name
KCRB_HUMAN

NCBI Description

The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in brain as well as in other tissues, and as a heterodimer with a similar muscle isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. A pseudogene of this gene has been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

CKB: Reversibly catalyzes the transfer of phosphate between ATP and various phosphogens (e.g. creatine phosphate). Creatine kinase isoenzymes play a central role in energy transduction in tissues with large, fluctuating energy demands, such as skeletal muscle, heart, brain and spermatozoa. Belongs to the ATP:guanido phosphotransferase family.

Protein type: Amino Acid Metabolism - arginine and proline; Kinase, other; EC 2.7.3.2

Chromosomal Location of Human Ortholog: 14q32

Cellular Component: cytoplasm; cytosol; extracellular space

Molecular Function: creatine kinase activity; protein binding; ubiquitin protein ligase binding

Biological Process: creatine metabolic process; substantia nigra development

Research Articles on CKB

Similar Products

Product Notes

The CKB ckb (Catalog #AAA1267009) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccttct ccaacagcca caacgcactg aagctgcgct tcccggccga ggacgagttc cccgacctga gcgcccacaa caaccacatg gccaaggtgc tgacccccga gctgtacgcg gagctgcgcg ccaagagcac gccgagcggc ttcacgctgg acgacgtcat ccagacaggc gtggacaacc cgggccatcc gtacatcatg accgtgggct gcgtggcggg cgacgaggag tcctacgaag tgttcaagga tctcttcgac cccatcatcg aggaccggca cggcggctac aagcccagcg atgagcacaa gaccgacctc aaccccgaca acctgcaggg cggcgacgac ctggacccca actacgtgct gagctcgcgg gtgcgcacgg gccgcagcat ccgtggcttc tgcctccccc cgcactgcag ccgcggggag cgccgagcca tcgagaagct cgcggtggaa gccctgtcca gcctggacgg cgacctggcg ggccgatact acgcgctcaa gagcatgacg gaggcggagc agcagcagct catcgacgac cacttcctct tcgacaagcc cgtgtcgccc ctgctgctgg cctcgggcat ggcccgcgac tggcccgacg cccgcggtat ctggcacaat gacaataaga ccttcctggt gtgggtcaac gaggaggacc acctgcgggt catctccatg cagaaggggg gcaacatgaa ggaggtgttc acccgcttct gcaccggcct cacccagatt gaaactctct tcaagtctaa ggactatgag ttcatgtgga accctcacct gggctacatc ctcacctgcc catccaacct gggcaccggg ctgcgggcag gtgtgcatat caagctgccc aacctgggca agcatgagaa gttctcggag gtgcttaagc ggctgcgact tcagaagcga ggcacaggcg gtgtggacac ggctgcggtg ggcggggtct tcgacgtctc caacgctgac cgcctgggct tctcagaggt ggagctggtg cagatggtgg tggacggagt gaagctgctc atcgagatgg aacagcggct ggagcagggc caggccatcg acgacctcat gcctgcccag aaatga. It is sometimes possible for the material contained within the vial of "CKB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.