SRP9 cdna clone

SRP9 cDNA Clone

Cat. Num. AAA1266968

• Gene Names: SRP9; ALURBP
• Synonyms: SRP9; SRP9 cDNA Clone; SRP9 cdna clone

• Sequence: atgccgcagtaccagacctgggaggagttcagccgcgctgccgagaagctttacctcgctgaccctatgaaggcacgtgtggttctcaaatataggcattctgatgggaacttgtgtgttaaagtaacagatgatttagtttgtttggtgtataaaacagaccaagctcaagatgtaaagaagattgagaaattccacagtcaactaatgcgacttatggtagccaaggaagcccgcaatgttaccatggaaactgagtga
• Sequence Length: 261

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 14250076
• NCBI GeneID: 6726
• Molecular Weight: 9,124 Da
• NCBI Official Full Name: Homo sapiens signal recognition particle 9kDa, mRNA
• NCBI Official Synonym Full Names: signal recognition particle 9
• NCBI Official Symbol: SRP9
• NCBI Official Synonym Symbols: ALURBP
• NCBI Protein Information: signal recognition particle 9 kDa protein
• UniProt Protein Name: Signal recognition particle 9 kDa protein
• Protein Family: Signal recognition particle 9 kDa protein
• UniProt Gene Name: SRP9
• UniProt Synonym Gene Names: SRP9
• UniProt Entry Name: SRP09_HUMAN

Uniprot Description

SRP9: Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding. Belongs to the SRP9 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Translation; RNA-binding

Chromosomal Location of Human Ortholog: 1q42.12

Cellular Component: cytosol; signal recognition particle receptor complex; signal recognition particle, endoplasmic reticulum targeting

Molecular Function: protein binding; RNA binding; signal recognition particle binding

Biological Process: SRP-dependent cotranslational protein targeting to membrane; SRP-dependent cotranslational protein targeting to membrane, translocation