ZNF597 cdna clone
ZNF597 cDNA Clone
Gene Names
ZNF597; HIT-4
Synonyms
ZNF597; ZNF597 cDNA Clone; ZNF597 cdna clone
Sequence
atggcgtccatgcccccgacgcccgaggcccagggaccaatactgtttgaggatctggctgtgtatttttctcaagaggagtgcgtgactctgcaccctgcccagaggtccctcagcaaagatggtacaaaagagtctttggaggatgcggctttgatgggagaggaaggcaagcctgagattaatcagcagttaagcctagagtctatggaacttgacgagcttgccttagaaaagtaccccattgctgcaccccttgtcccttacccagaaaaatcctctgaggatggagttggaaaccctgaagcgaaaatattaagtggaactcccacttacaagagaagggtcatcagccttttagttaccattgaaaaccacaccccattagtagaactctctgaatatttaggaaccaacacactttctgaaattcttgattctccctgggaaggagccaaaaatgtgtacaaatgtcctgagtgtgaccaaaacttcagcgatcattcatacctagttttgcatcagaaaattcattcaggagagaaaaaacataaatgtggtgactgtggaaagatcttcaatcatagagccaacctgaggacacacaggagaatccatactggtgagaaaccttataagtgtgccaagtgcagtgccagctttcgccagcactctcatctatcccgacacatgaatagccacgtaaaggagaagccctatacatgtagcatatgtggtagaggttttatgtggctcccaggattggcacagcatcagaaaagccacagtgctgaaaacacctacgaatctactaactgtgataaacattttaatgagaaaccaaatcttgctttgcctgaggaaacattcgtatcaggcccccagtaccagcacactaagtgcatgaagagcttcaggcagtccttatatcctgccctttccgagaagagccacgacgaggactctgaacgctgcagcgatgatggggacaatttcttctcattctcaaaattcaagcccttacagtgtcctgactgtgacatgacctttccttgtttctctgagcttatttcccatcagaacattcatacagaggaaaggccccataagtgcaaaacatgcgaggaaagttttgctttggactcagaacttgcatgccaccagaagagccacatgctagcggaaccttttaaatgtaccgtgtgtgggaaaactttcaagtcgaatttgcatctcattactcataagcgaactcacataaaaaacaccacgtaa
Sequence Length
1275
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,076 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 597, mRNA
NCBI Official Synonym Full Names
zinc finger protein 597
NCBI Official Symbol
ZNF597
NCBI Official Synonym Symbols
HIT-4
NCBI Protein Information
zinc finger protein 597
UniProt Protein Name
Zinc finger protein 597
Protein Family
UniProt Gene Name
ZNF597
UniProt Entry Name
ZN597_HUMAN
NCBI Description
This gene encodes a protein with multiple zinc finger domains. Loss of the related gene in rodents results in defects in neural development and embryonic lethality in mutant homozygotes. This gene is adjacent to a differentially methylated region (DMR) and is imprinted and maternally expressed. [provided by RefSeq, Nov 2015]
Uniprot Description
ZNF597: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: Transcription regulation; DNA-binding; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 16p13.3
Similar Products
Product Notes
The ZNF597 znf597 (Catalog #AAA1266957) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtcca tgcccccgac gcccgaggcc cagggaccaa tactgtttga ggatctggct gtgtattttt ctcaagagga gtgcgtgact ctgcaccctg cccagaggtc cctcagcaaa gatggtacaa aagagtcttt ggaggatgcg gctttgatgg gagaggaagg caagcctgag attaatcagc agttaagcct agagtctatg gaacttgacg agcttgcctt agaaaagtac cccattgctg caccccttgt cccttaccca gaaaaatcct ctgaggatgg agttggaaac cctgaagcga aaatattaag tggaactccc acttacaaga gaagggtcat cagcctttta gttaccattg aaaaccacac cccattagta gaactctctg aatatttagg aaccaacaca ctttctgaaa ttcttgattc tccctgggaa ggagccaaaa atgtgtacaa atgtcctgag tgtgaccaaa acttcagcga tcattcatac ctagttttgc atcagaaaat tcattcagga gagaaaaaac ataaatgtgg tgactgtgga aagatcttca atcatagagc caacctgagg acacacagga gaatccatac tggtgagaaa ccttataagt gtgccaagtg cagtgccagc tttcgccagc actctcatct atcccgacac atgaatagcc acgtaaagga gaagccctat acatgtagca tatgtggtag aggttttatg tggctcccag gattggcaca gcatcagaaa agccacagtg ctgaaaacac ctacgaatct actaactgtg ataaacattt taatgagaaa ccaaatcttg ctttgcctga ggaaacattc gtatcaggcc cccagtacca gcacactaag tgcatgaaga gcttcaggca gtccttatat cctgcccttt ccgagaagag ccacgacgag gactctgaac gctgcagcga tgatggggac aatttcttct cattctcaaa attcaagccc ttacagtgtc ctgactgtga catgaccttt ccttgtttct ctgagcttat ttcccatcag aacattcata cagaggaaag gccccataag tgcaaaacat gcgaggaaag ttttgctttg gactcagaac ttgcatgcca ccagaagagc cacatgctag cggaaccttt taaatgtacc gtgtgtggga aaactttcaa gtcgaatttg catctcatta ctcataagcg aactcacata aaaaacacca cgtaa. It is sometimes possible for the material contained within the vial of "ZNF597, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
