Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHX57 cdna clone

DHX57 cDNA Clone

Gene Names
DHX57; DDX57
Synonyms
DHX57; DHX57 cDNA Clone; DHX57 cdna clone
Ordering
For Research Use Only!
Sequence
atgacttctgagaatcaagagaaagtgaaagctcttctccgagacctgcaagaacaagatgctgatgctggatctgaaagaggcctttctggggaggaggaagatgatgagcctgattgctgtaacgatgagcggtactggccagctggacaggaaccttccctcgttcccgacttggatcctttggaatatgctggcttagcctcagtggagccttatgttccagaatttacagtctccccatttgcagtgcaaaaactttccaggtatggtttcaatactgaacgctgtcaagcggtcctgaggatgtgtgatggagatgtgggagcatcactagagcatctccttacccagtgtttttcagagacatttggagagaggatgaagatctctgaggcagtcaaccagataagcttggatgagtgtatggaacagcgacaggaagaggcatttgctctcaagtccatctgtggagaaaaatttatagaaagaattcagaacagagtctggaccattgggttagaactggagtatctgacaagtagattccgcaaatccaagccaaaagaaagtaccaaaaatgtacaagagaattcacttgaaatctgtaaattttacctcaaaggaaattgtaaatttggatcaaaatgcagattcaaacatgaagtgcccccaaatcaaattgttggaagaatagaaagaagtgtagatgattctcatcttaatgctattgaagatgcatcttttttatatgaacttgaaattcgattttctaaagaccacaaatatccctaccaagctccgctcgtggcattttattccaccaatgagaacctacctctggcttgtcgtttacatatttctgagtttctttatgacaaggccttgacatttgcggaaacttcggaacctgtcgtatattctttgataacccttttagaggaagagtcggaaatagtcaagttactaacgaatacccaccacaagtatagtgatcctcctgtgaactttctgccagtaccctctaggaccagaataaataatcctgcctgtcataaaacagtgattccaaataattcttttgtttctaatcaaattccagaagttgaaaaagcatcagaatctgaggagtcagatgaggatgacggtcctgcacctgttatagtagagaatgaaagctatgtgaaccttaagaaaaagatttccaaaagatatgactggcaggcaaagtcagtacatgctgaaaatggtaaaatctgcaagcagttccgaatgaaacaggcttccagacagttccagtccattctgcaagagaggcaatcactccctgcttgggaagaaagagaaaccattcttaacttattgcgtaagcaccaggtggttgtcataagtggtatgactggatgtgggaaaaccacacaaattccgcagtttattctggatgattctctgagtggaccacctgagaaggtagccaacatcatctgtacccaaccccgacgaatctctgcaatctctgttgctgaacgcgttgctaaagaaagagcagagagggtgggtctgaccgtgggataccagattcggttagaaagtgtcaaggtttgtatgctctgcttatttcctggtaacagaaatttatggtttttaggtataaaaagttttgggggttag
Sequence Length
1671
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,508 Da
NCBI Official Full Name
Homo sapiens DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57, mRNA
NCBI Official Synonym Full Names
DEAH-box helicase 57
NCBI Official Symbol
DHX57
NCBI Official Synonym Symbols
DDX57
NCBI Protein Information
putative ATP-dependent RNA helicase DHX57
UniProt Protein Name
Putative ATP-dependent RNA helicase DHX57
UniProt Gene Name
DHX57
UniProt Entry Name
DHX57_HUMAN

Uniprot Description

DHX57: Probable ATP-binding RNA helicase. Belongs to the DEAD box helicase family. DEAH subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.4.13; Helicase; RNA-binding

Chromosomal Location of Human Ortholog: 2p22.1

Cellular Component: mitochondrion; nucleus

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: RNA processing

Similar Products

Product Notes

The DHX57 dhx57 (Catalog #AAA1266953) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacttctg agaatcaaga gaaagtgaaa gctcttctcc gagacctgca agaacaagat gctgatgctg gatctgaaag aggcctttct ggggaggagg aagatgatga gcctgattgc tgtaacgatg agcggtactg gccagctgga caggaacctt ccctcgttcc cgacttggat cctttggaat atgctggctt agcctcagtg gagccttatg ttccagaatt tacagtctcc ccatttgcag tgcaaaaact ttccaggtat ggtttcaata ctgaacgctg tcaagcggtc ctgaggatgt gtgatggaga tgtgggagca tcactagagc atctccttac ccagtgtttt tcagagacat ttggagagag gatgaagatc tctgaggcag tcaaccagat aagcttggat gagtgtatgg aacagcgaca ggaagaggca tttgctctca agtccatctg tggagaaaaa tttatagaaa gaattcagaa cagagtctgg accattgggt tagaactgga gtatctgaca agtagattcc gcaaatccaa gccaaaagaa agtaccaaaa atgtacaaga gaattcactt gaaatctgta aattttacct caaaggaaat tgtaaatttg gatcaaaatg cagattcaaa catgaagtgc ccccaaatca aattgttgga agaatagaaa gaagtgtaga tgattctcat cttaatgcta ttgaagatgc atctttttta tatgaacttg aaattcgatt ttctaaagac cacaaatatc cctaccaagc tccgctcgtg gcattttatt ccaccaatga gaacctacct ctggcttgtc gtttacatat ttctgagttt ctttatgaca aggccttgac atttgcggaa acttcggaac ctgtcgtata ttctttgata acccttttag aggaagagtc ggaaatagtc aagttactaa cgaataccca ccacaagtat agtgatcctc ctgtgaactt tctgccagta ccctctagga ccagaataaa taatcctgcc tgtcataaaa cagtgattcc aaataattct tttgtttcta atcaaattcc agaagttgaa aaagcatcag aatctgagga gtcagatgag gatgacggtc ctgcacctgt tatagtagag aatgaaagct atgtgaacct taagaaaaag atttccaaaa gatatgactg gcaggcaaag tcagtacatg ctgaaaatgg taaaatctgc aagcagttcc gaatgaaaca ggcttccaga cagttccagt ccattctgca agagaggcaa tcactccctg cttgggaaga aagagaaacc attcttaact tattgcgtaa gcaccaggtg gttgtcataa gtggtatgac tggatgtggg aaaaccacac aaattccgca gtttattctg gatgattctc tgagtggacc acctgagaag gtagccaaca tcatctgtac ccaaccccga cgaatctctg caatctctgt tgctgaacgc gttgctaaag aaagagcaga gagggtgggt ctgaccgtgg gataccagat tcggttagaa agtgtcaagg tttgtatgct ctgcttattt cctggtaaca gaaatttatg gtttttaggt ataaaaagtt ttgggggtta g. It is sometimes possible for the material contained within the vial of "DHX57, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.