PSG11 cdna clone
PSG11 cDNA Clone
Gene Names
PSG11; PSG13; PSG14; PSBG-11; PSBG-13
Synonyms
PSG11; PSG11 cDNA Clone; PSG11 cdna clone
Sequence
atgcacgcagcagagatcatggggcccctctcagcccctccctgcacagagcacatcaaatggaaggggctcctgctcacagtggagactcccaagccctccatctccagcagcaacttaaaccccagggaggccatggagactgtgatcttaacctgtaatcctgagactccggacgcaagctacctgtggtggatgaatggtcagagcctccctatgactcataggatgcagctgtctgaaaccaacaggaccctctttctatttggtgtcacaaagtatactgcaggaccctatgaatgtgaaatatggaactcagggagtgccagccgcagtgacccagtcaccctgaatctcctccatggtccagacctccccagaattttcccttcagtcacctcttactattcaggagagaacctcgacttgtcctgcttcgcagactctaacccaccagcacagtattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatccctcaaattactccaaagcataatgggctctatgcttgctctgctcgtaactcagccactggcgaggaaagctccacatccttgacaatcagagtcattgctcctccaggattaggaacttttgctttcaataatccaacgtag
Sequence Length
660
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,359 Da
NCBI Official Full Name
Homo sapiens pregnancy specific beta-1-glycoprotein 11, mRNA
NCBI Official Synonym Full Names
pregnancy specific beta-1-glycoprotein 11
NCBI Official Symbol
PSG11
NCBI Official Synonym Symbols
PSG13; PSG14; PSBG-11; PSBG-13
NCBI Protein Information
pregnancy-specific beta-1-glycoprotein 11
UniProt Protein Name
Pregnancy-specific beta-1-glycoprotein 11
Protein Family
UniProt Gene Name
PSG11
UniProt Synonym Gene Names
PSG13; PSG14; PS-beta-G-11; PSBG-11; Pregnancy-specific glycoprotein 11; PS-beta-G-13; PSBG-13; Pregnancy-specific glycoprotein 13
UniProt Entry Name
PSG11_HUMAN
NCBI Description
The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
Uniprot Description
PSG11: Belongs to the immunoglobulin superfamily. CEA family. 2 isoforms of the human protein are produced by alternative splicing
Protein type: Secreted; Motility/polarity/chemotaxis; Secreted, signal peptide
Chromosomal Location of Human Ortholog: 19q13.2
Biological Process: female pregnancy
Research Articles on PSG11
Similar Products
Product Notes
The PSG11 psg11 (Catalog #AAA1266914) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacgcag cagagatcat ggggcccctc tcagcccctc cctgcacaga gcacatcaaa tggaaggggc tcctgctcac agtggagact cccaagccct ccatctccag cagcaactta aaccccaggg aggccatgga gactgtgatc ttaacctgta atcctgagac tccggacgca agctacctgt ggtggatgaa tggtcagagc ctccctatga ctcataggat gcagctgtct gaaaccaaca ggaccctctt tctatttggt gtcacaaagt atactgcagg accctatgaa tgtgaaatat ggaactcagg gagtgccagc cgcagtgacc cagtcaccct gaatctcctc catggtccag acctccccag aattttccct tcagtcacct cttactattc aggagagaac ctcgacttgt cctgcttcgc agactctaac ccaccagcac agtattcttg gacaattaat gggaagtttc agctatcagg acaaaagctc tttatccctc aaattactcc aaagcataat gggctctatg cttgctctgc tcgtaactca gccactggcg aggaaagctc cacatccttg acaatcagag tcattgctcc tccaggatta ggaacttttg ctttcaataa tccaacgtag. It is sometimes possible for the material contained within the vial of "PSG11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
