Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VPS37D cdna clone

VPS37D cDNA Clone

Gene Names
VPS37D; WBSCR24
Synonyms
VPS37D; VPS37D cDNA Clone; VPS37D cdna clone
Ordering
For Research Use Only!
Sequence
atgcatcgctggagtccccactgcgcgctgggctggctgcaggctgagctagaagaggcggagcaggaggcagaggagcagatggagcagctgctgctcggggagcaaagcctggaggccttcctgcctgccttccagcgtggccgcgccctggcccacctgaggcggacgcaggcagagaagctgcaggagctgctgcggcgtcgggagcgttctgcccagccggcccccacctcggctgctgatccccccaaatccttcccggctgcagctgtcctgcccactggggccgcccgggggccaccagcagtgccccggagcctgccccccttggactcccgcccagtgcccccactgaagggctcccccgggtgccccctcggcccggcccccctgctgagccctcggccctcgcagccagagcccccccaccggtag
Sequence Length
438
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,730 Da
NCBI Official Full Name
Homo sapiens vacuolar protein sorting 37 homolog D (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
VPS37D, ESCRT-I subunit
NCBI Official Symbol
VPS37D
NCBI Official Synonym Symbols
WBSCR24
NCBI Protein Information
vacuolar protein sorting-associated protein 37D
UniProt Protein Name
Vacuolar protein sorting-associated protein 37D
UniProt Gene Name
VPS37D
UniProt Entry Name
VP37D_HUMAN

Uniprot Description

VPS37D: Component of the ESCRT-I complex, a regulator of vesicular trafficking process. Required for the sorting of endocytic ubiquitinated cargos into multivesicular bodies. May be involved in cell growth and differentiation. VPS37D is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region. Belongs to the VPS37 family.

Chromosomal Location of Human Ortholog: 7q11.23

Cellular Component: endosome membrane

Biological Process: autophagy; endosome transport; viral infectious cycle

Similar Products

Product Notes

The VPS37D vps37d (Catalog #AAA1266834) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcatcgct ggagtcccca ctgcgcgctg ggctggctgc aggctgagct agaagaggcg gagcaggagg cagaggagca gatggagcag ctgctgctcg gggagcaaag cctggaggcc ttcctgcctg ccttccagcg tggccgcgcc ctggcccacc tgaggcggac gcaggcagag aagctgcagg agctgctgcg gcgtcgggag cgttctgccc agccggcccc cacctcggct gctgatcccc ccaaatcctt cccggctgca gctgtcctgc ccactggggc cgcccggggg ccaccagcag tgccccggag cctgcccccc ttggactccc gcccagtgcc cccactgaag ggctcccccg ggtgccccct cggcccggcc cccctgctga gccctcggcc ctcgcagcca gagccccccc accggtag. It is sometimes possible for the material contained within the vial of "VPS37D, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.