MAPK6 cdna clone
MAPK6 cDNA Clone
Gene Names
MAPK6; ERK3; PRKM6; p97MAPK; HsT17250
Synonyms
MAPK6; MAPK6 cDNA Clone; MAPK6 cdna clone
Sequence
atggcagagaaatttgaaagtctcatgaacattcatggttttgatctgggttctaggtatatggacttaaaaccattgggttgtggaggcaatggcttggttttttctgctgtagacaatgactgtgacaaaagagtagccatcaagaaaattgtccttactgatccccagagtgtcaaacatgctctacgtgaaatcaaaattattagaagacttgaccatgataacattgtgaaagtgtttgagattcttggtcccagtggaagccaattaacagacgatgtgggctctcttacggaactgaacagtgtttacattgttcaggagtacatggagacagacttggctaatgtgctggagcagggccctttactggaagagcatgccaggcttttcatgtatcagctgctacgggggctcaagtatattcactctgcaaatgtactgcacagagatctcaaaccagctaatcttttcattaatacggaagacttggtgctgaagataggtgactttggtcttgcacggatcatggatcctcattattcccataagggtcatctttctgaaggattggttactaaatggtacagatctccacgtcttttactttctcctaataattatactaaagccattgacatgtgggctgcaggctgcatctttgctgaaatgctgactggtaaaaccctttttgcaggtgcacatgaacttgaacagatgcagctgattttagaatctattcctgttgtacatgaggaagatcgtcaggagcttctcagcgtaattccagtttacattagaaatgacatgactgagccacacaaacctttaactcagctgcttccaggaattagtcgagaagcagtggatttcctggaacaaattttgacatttagccccatggatcggttaacagcagaagaagcactctcccatccttacatgagcatatattcttttccaatggatgagccaatttcaagccatccttttcatattgaagatgaagttgatgatattttgcttatggatgaaactcacagtcacatttataactgggaaaggtatcatgattgtcagttttcagagcatgattggcctgtacataacaactttgatattgatgaagttcagcttgatccaagagctctgtccgatgtcactgatgaagaagaagtacaagttgatccccgaaaatatttggatggagatcgggaaaagtatctggaggatcctgcttttgataccaattactctactgagccttgttggcaatactcagatcatcatgaaaacaaatattgtgatctggagtgtagccatacttgtaactacaaaacgaggtcatcatcatatttagataacttagtttggagagagagtgaagttaaccattactatgaacccaagcttattatagatctttccaattggaaagaacaaagcaaagaaaaatctgataagaaaggcaaatcaaaatgtgaaaggaatggattggttaaagcccagatagcgctagaggaagcatcacagcaactggctggaaaagaaagggaaaagaatcagggatttgattttgattcctttattgcaggaactattcagcttagttcccagcatgagcctactgatgttgttgataaattaaatgacttgaatagctcagtgtcccaactagaattgaaaagtttgatatcaaagtcagtaagccaagaaaaacaggaaaaaggaatggcaaatctggctcaattagaagccttgtaccagtcttcttgggacagccagtttgtgagtggtggggaggactgttttttcataaatcagttttgtgaggtaaggaaggatgaacaagttgagaaggaaaacacttacactagttacttggacaagttctttagcaggaaagaagatactgaaatgctagaaactgagccagtagaggatgggaagcttggggagagaggacatgaggaaggatttctgaacaacagtggggagttcctctttaacaagcagctcgagtccataggcatcccacagtttcacagtccagttgggtcaccacttaagtcaatacaggccacattaacaccttctgctatgaaatcttcccctcaaattcctcatcaaacatacagcagcattctgaaacatctgaactaa
Sequence Length
2166
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
82,681 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase 6, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase 6
NCBI Official Symbol
MAPK6
NCBI Official Synonym Symbols
ERK3; PRKM6; p97MAPK; HsT17250
NCBI Protein Information
mitogen-activated protein kinase 6
UniProt Protein Name
Mitogen-activated protein kinase 6
UniProt Gene Name
MAPK6
UniProt Synonym Gene Names
ERK3; PRKM6; MAP kinase 6; MAPK 6; ERK-3; p97-MAPK
UniProt Entry Name
MK06_HUMAN
NCBI Description
The protein encoded by this gene is a member of the Ser/Thr protein kinase family, and is most closely related to mitogen-activated protein kinases (MAP kinases). MAP kinases also known as extracellular signal-regulated kinases (ERKs), are activated through protein phosphorylation cascades and act as integration points for multiple biochemical signals. This kinase is localized in the nucleus, and has been reported to be activated in fibroblasts upon treatment with serum or phorbol esters. [provided by RefSeq, Jul 2008]
Uniprot Description
ERK3: a protein kinase of the MAPK family. Plays a critical role in the regulation of cell growth and differentiation. Localized in the nucleus, and has been reported to be activated in fibroblasts upon treatment with serum or phorbol esters.
Protein type: EC 2.7.11.24; Protein kinase, Ser/Thr (non-receptor); Protein kinase, CMGC; Kinase, protein; CMGC group; MAPK family; MAPK/ERK subfamily; ERK subfamily
Chromosomal Location of Human Ortholog: 15q21
Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus
Molecular Function: MAP kinase activity; protein binding; protein serine/threonine kinase activity
Biological Process: protein amino acid phosphorylation; signal transduction
Research Articles on MAPK6
Similar Products
Product Notes
The MAPK6 mapk6 (Catalog #AAA1266806) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaga aatttgaaag tctcatgaac attcatggtt ttgatctggg ttctaggtat atggacttaa aaccattggg ttgtggaggc aatggcttgg ttttttctgc tgtagacaat gactgtgaca aaagagtagc catcaagaaa attgtcctta ctgatcccca gagtgtcaaa catgctctac gtgaaatcaa aattattaga agacttgacc atgataacat tgtgaaagtg tttgagattc ttggtcccag tggaagccaa ttaacagacg atgtgggctc tcttacggaa ctgaacagtg tttacattgt tcaggagtac atggagacag acttggctaa tgtgctggag cagggccctt tactggaaga gcatgccagg cttttcatgt atcagctgct acgggggctc aagtatattc actctgcaaa tgtactgcac agagatctca aaccagctaa tcttttcatt aatacggaag acttggtgct gaagataggt gactttggtc ttgcacggat catggatcct cattattccc ataagggtca tctttctgaa ggattggtta ctaaatggta cagatctcca cgtcttttac tttctcctaa taattatact aaagccattg acatgtgggc tgcaggctgc atctttgctg aaatgctgac tggtaaaacc ctttttgcag gtgcacatga acttgaacag atgcagctga ttttagaatc tattcctgtt gtacatgagg aagatcgtca ggagcttctc agcgtaattc cagtttacat tagaaatgac atgactgagc cacacaaacc tttaactcag ctgcttccag gaattagtcg agaagcagtg gatttcctgg aacaaatttt gacatttagc cccatggatc ggttaacagc agaagaagca ctctcccatc cttacatgag catatattct tttccaatgg atgagccaat ttcaagccat ccttttcata ttgaagatga agttgatgat attttgctta tggatgaaac tcacagtcac atttataact gggaaaggta tcatgattgt cagttttcag agcatgattg gcctgtacat aacaactttg atattgatga agttcagctt gatccaagag ctctgtccga tgtcactgat gaagaagaag tacaagttga tccccgaaaa tatttggatg gagatcggga aaagtatctg gaggatcctg cttttgatac caattactct actgagcctt gttggcaata ctcagatcat catgaaaaca aatattgtga tctggagtgt agccatactt gtaactacaa aacgaggtca tcatcatatt tagataactt agtttggaga gagagtgaag ttaaccatta ctatgaaccc aagcttatta tagatctttc caattggaaa gaacaaagca aagaaaaatc tgataagaaa ggcaaatcaa aatgtgaaag gaatggattg gttaaagccc agatagcgct agaggaagca tcacagcaac tggctggaaa agaaagggaa aagaatcagg gatttgattt tgattccttt attgcaggaa ctattcagct tagttcccag catgagccta ctgatgttgt tgataaatta aatgacttga atagctcagt gtcccaacta gaattgaaaa gtttgatatc aaagtcagta agccaagaaa aacaggaaaa aggaatggca aatctggctc aattagaagc cttgtaccag tcttcttggg acagccagtt tgtgagtggt ggggaggact gttttttcat aaatcagttt tgtgaggtaa ggaaggatga acaagttgag aaggaaaaca cttacactag ttacttggac aagttcttta gcaggaaaga agatactgaa atgctagaaa ctgagccagt agaggatggg aagcttgggg agagaggaca tgaggaagga tttctgaaca acagtgggga gttcctcttt aacaagcagc tcgagtccat aggcatccca cagtttcaca gtccagttgg gtcaccactt aagtcaatac aggccacatt aacaccttct gctatgaaat cttcccctca aattcctcat caaacataca gcagcattct gaaacatctg aactaa. It is sometimes possible for the material contained within the vial of "MAPK6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
