Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HMG20B cdna clone

HMG20B cDNA Clone

Gene Names
HMG20B; SOXL; HMGX2; BRAF25; BRAF35; HMGXB2; PP7706; pp8857; SMARCE1r
Synonyms
HMG20B; HMG20B cDNA Clone; HMG20B cdna clone
Ordering
For Research Use Only!
Sequence
atgctgggcgccgagtggagcaagctgcagccaacggaaaagcagcggtacctggatgaggccgagagagagaagcagcagtacatgaaggagctgcgggcgtaccagcagtctgaagcctataagatgtgcacggagaagatccaggagaagaagatcaagaaagaagactcgagctctgggctcatgaacactctcctgaatggacacaagggtggggactgcgatggcttctccaccttcgatgttcccatcttcactgaagagttcttggaccaaaacaaagcgcgtgaggcggagcttcggcgcttgcggaagatgaatgtggccttcgaggagcagaacgcggtactgcagaggcacacgcagagcatgagcagcgcgcgcgagcgtctggagcaggagctggcgctggaggagcggaggacgctggcgctgcagcagcagctccaggccgtgcgccaggcgctcaccgccagcttcgcctcactgccggtgccgggcacgggcgaaacgcccacgctgggcactctggacttctacatggcccggcttcacggagccatcgagcgcgaccccgcccagcacgagaagctcatcgtccgcatcaaggaaatcctggcccaggtcgccagcgagcacctgtga
Sequence Length
648
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,939 Da
NCBI Official Full Name
Homo sapiens high-mobility group 20B, mRNA
NCBI Official Synonym Full Names
high mobility group 20B
NCBI Official Symbol
HMG20B
NCBI Official Synonym Symbols
SOXL; HMGX2; BRAF25; BRAF35; HMGXB2; PP7706; pp8857; SMARCE1r
NCBI Protein Information
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-related
UniProt Protein Name
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-related
UniProt Gene Name
HMG20B
UniProt Synonym Gene Names
BRAF35; HMGX2; HMGXB2; SMARCE1R; SMARCE1-related protein
UniProt Entry Name
HM20B_HUMAN

Uniprot Description

HMG20B: Required for correct progression through G2 phase of the cell cycle and entry into mitosis. Required for RCOR1/CoREST mediated repression of neuronal specific gene promoters. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: nucleoplasm

Molecular Function: histone deacetylase activity; protein binding

Biological Process: blood coagulation

Research Articles on HMG20B

Similar Products

Product Notes

The HMG20B hmg20b (Catalog #AAA1266802) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgggcg ccgagtggag caagctgcag ccaacggaaa agcagcggta cctggatgag gccgagagag agaagcagca gtacatgaag gagctgcggg cgtaccagca gtctgaagcc tataagatgt gcacggagaa gatccaggag aagaagatca agaaagaaga ctcgagctct gggctcatga acactctcct gaatggacac aagggtgggg actgcgatgg cttctccacc ttcgatgttc ccatcttcac tgaagagttc ttggaccaaa acaaagcgcg tgaggcggag cttcggcgct tgcggaagat gaatgtggcc ttcgaggagc agaacgcggt actgcagagg cacacgcaga gcatgagcag cgcgcgcgag cgtctggagc aggagctggc gctggaggag cggaggacgc tggcgctgca gcagcagctc caggccgtgc gccaggcgct caccgccagc ttcgcctcac tgccggtgcc gggcacgggc gaaacgccca cgctgggcac tctggacttc tacatggccc ggcttcacgg agccatcgag cgcgaccccg cccagcacga gaagctcatc gtccgcatca aggaaatcct ggcccaggtc gccagcgagc acctgtga. It is sometimes possible for the material contained within the vial of "HMG20B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.