ASMTL cdna clone
ASMTL cDNA Clone
Gene Names
ASMTL; ASTML; ASMTLX; ASMTLY
Synonyms
ASMTL; ASMTL cDNA Clone; ASMTL cdna clone
Sequence
atggtgctgtgcccggtgattgggaagctgctgcacaagcgcgtggtgctggccagcgcctccccacgccgtcaggagatcctcagcaacgcgggtctcaggtttgaggtggtcccctccaagtttaaagagaagctggacaaagcctccttcgctactccgtatgggtacgccatggagaccgccaagcagaaggccctggaggtggccaaccggctgtaccagaaagacctgcgggcccccgacgtggtcattggagcggacacgatcgtgacggtcggggggctgattctggagaagccggtggacaagcaggacgcctacaggatgctgtcccggttgagtgggagagaacacagcgtgttcacaggtgtcgcgatcgtccactgctccagcaaagaccatcagctggacaccagggtctcggaattctacgaggaaacgaaggtgaagttctcggagctgtccgaggagctgctctgggaatacgtccacagcggggagcccatggacaaagctggcggctacgggatccaggccctgggcggcatgctggtggagtccgtacacggggactttctgaacgtggtgggattcccgctgaaccacttctgcaagcagctggtgaagctctactacccgccccgcccggaggacctgcggcggagtgtcaagcacgactccatcccggccgcggacaccttcgaagacctcagtgacgtggaggggggtggctcggagcccactcagagggacgcgggcagccgcgatgagaaagccgaggcgggagaggcgggacaggccacggcagaggctgagtgtcacaggactcgggagaccctgcctccgttcccgacacgcctcctggagctgattgagggctttatgctatccaagggcctgctcaccgcttgcaaactgaaggtgttcgatttgttaaaagatgaagcaccccagaaggctgcggatattgccagcaaagtggacgcctctgcgtgtggaatggagaggcttctggacatctgtgctgccatggggctcctggagaagacagagcaaggttacagtaacacagagacagcgaacgtctacctggcatcggatggcgaatactctctgcacggcttcatcatgcacaataatgacctcacatggaacctctttacatacctggagtttgccatccgagagggaacaaaccagcaccacagggcgttggggaagaaggcggaagatctgttccaggatgcgtactaccagagcccggagacgcggctgaggttcatgcgggccatgcacggcatgacgaagctgactgcgtgccaggtggccacggccttcaatctgtcccgcttctcctccgcctgcgacgtgggaggctgcaccggtgcactggcccgagagctggcccgtgagtaccctcgtatgcaggtgactgtgtttgacctcccagacattatcgagctggccgcccacttccaaccccccggaccgcaggcagtgcagatccacttcgcagcaggtgactttttcagggaccccctccccagcgctgagctgtacgtcctgtgccggatcctgcatgactggccagacgacaaagtccacaagttactcagcaaggtcgccgagagctgcaagccaggggccggcctgctgctggtggagacgctcctggatgaggagaagagggtggcgcagcgcgccctgatgcagtcactgaacatgctggtgcagactgaaggcaaggagcggagcctgggcgagtatcagtgcttgctggagctgcacggcttccaccaggtgcaggtggtgcacttggggggtgtcctggatgccatcttggccaccaaagtggccccctga
Sequence Length
1866
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
62,443 Da
NCBI Official Full Name
Homo sapiens acetylserotonin O-methyltransferase-like, mRNA
NCBI Official Synonym Full Names
acetylserotonin O-methyltransferase-like
NCBI Official Symbol
ASMTL
NCBI Official Synonym Symbols
ASTML; ASMTLX; ASMTLY
NCBI Protein Information
N-acetylserotonin O-methyltransferase-like protein
UniProt Protein Name
N-acetylserotonin O-methyltransferase-like protein
Protein Family
UniProt Gene Name
ASMTL
UniProt Synonym Gene Names
ASMTL
UniProt Entry Name
ASML_HUMAN
NCBI Description
The protein encoded by this gene has an N-terminus that is similar to the multicopy associated filamentation (maf) protein of Bacillus subtilis and to orfE of Escherichia coli, while the C-terminus is similar to N-acetylserotonin O-methyltransferase. This gene is located in the pseudoautosomal region 1 (PAR1) of X and Y chromosomes. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Uniprot Description
ASMTL: Unknown. The presence of the putative catalytic domain of S-adenosyl-L-methionine binding argues for a methyltransferase activity. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Methyltransferase
Chromosomal Location of Human Ortholog: Xp22.3; Yp11.3
Cellular Component: cytoplasm
Molecular Function: protein binding
Similar Products
Product Notes
The ASMTL asmtl (Catalog #AAA1266668) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgctgt gcccggtgat tgggaagctg ctgcacaagc gcgtggtgct ggccagcgcc tccccacgcc gtcaggagat cctcagcaac gcgggtctca ggtttgaggt ggtcccctcc aagtttaaag agaagctgga caaagcctcc ttcgctactc cgtatgggta cgccatggag accgccaagc agaaggccct ggaggtggcc aaccggctgt accagaaaga cctgcgggcc cccgacgtgg tcattggagc ggacacgatc gtgacggtcg gggggctgat tctggagaag ccggtggaca agcaggacgc ctacaggatg ctgtcccggt tgagtgggag agaacacagc gtgttcacag gtgtcgcgat cgtccactgc tccagcaaag accatcagct ggacaccagg gtctcggaat tctacgagga aacgaaggtg aagttctcgg agctgtccga ggagctgctc tgggaatacg tccacagcgg ggagcccatg gacaaagctg gcggctacgg gatccaggcc ctgggcggca tgctggtgga gtccgtacac ggggactttc tgaacgtggt gggattcccg ctgaaccact tctgcaagca gctggtgaag ctctactacc cgccccgccc ggaggacctg cggcggagtg tcaagcacga ctccatcccg gccgcggaca ccttcgaaga cctcagtgac gtggaggggg gtggctcgga gcccactcag agggacgcgg gcagccgcga tgagaaagcc gaggcgggag aggcgggaca ggccacggca gaggctgagt gtcacaggac tcgggagacc ctgcctccgt tcccgacacg cctcctggag ctgattgagg gctttatgct atccaagggc ctgctcaccg cttgcaaact gaaggtgttc gatttgttaa aagatgaagc accccagaag gctgcggata ttgccagcaa agtggacgcc tctgcgtgtg gaatggagag gcttctggac atctgtgctg ccatggggct cctggagaag acagagcaag gttacagtaa cacagagaca gcgaacgtct acctggcatc ggatggcgaa tactctctgc acggcttcat catgcacaat aatgacctca catggaacct ctttacatac ctggagtttg ccatccgaga gggaacaaac cagcaccaca gggcgttggg gaagaaggcg gaagatctgt tccaggatgc gtactaccag agcccggaga cgcggctgag gttcatgcgg gccatgcacg gcatgacgaa gctgactgcg tgccaggtgg ccacggcctt caatctgtcc cgcttctcct ccgcctgcga cgtgggaggc tgcaccggtg cactggcccg agagctggcc cgtgagtacc ctcgtatgca ggtgactgtg tttgacctcc cagacattat cgagctggcc gcccacttcc aaccccccgg accgcaggca gtgcagatcc acttcgcagc aggtgacttt ttcagggacc ccctccccag cgctgagctg tacgtcctgt gccggatcct gcatgactgg ccagacgaca aagtccacaa gttactcagc aaggtcgccg agagctgcaa gccaggggcc ggcctgctgc tggtggagac gctcctggat gaggagaaga gggtggcgca gcgcgccctg atgcagtcac tgaacatgct ggtgcagact gaaggcaagg agcggagcct gggcgagtat cagtgcttgc tggagctgca cggcttccac caggtgcagg tggtgcactt ggggggtgtc ctggatgcca tcttggccac caaagtggcc ccctga. It is sometimes possible for the material contained within the vial of "ASMTL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
