Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACP5 cdna clone

ACP5 cDNA Clone

Gene Names
ACP5; HPAP; TRAP; TRACP5a; TRACP5b; TrATPase
Synonyms
ACP5; ACP5 cDNA Clone; ACP5 cdna clone
Ordering
For Research Use Only!
Sequence
atggacatgtggacggcgctgctcatcctgcaagccttgttgctaccctccctggctgatggtgccacccctgccctgcgctttgtagccgtgggtgactggggaggggtccccaatgccccattccacacggcccgggaaatggccaatgccaaggagatcgctcggactgtgcagatcctgggtgcagacttcatcctgtctctaggggacaatttttacttcactggtgtgcaagacatcaatgacaagaggttccaggagacctttgaggacgtattctctgaccgctcccttcgcaaagtgccctggtacgtgctagccggaaaccatgaccaccttggcaatgtctctgcccagattgcatactctaagatctccaagcgctggaacttccccagccctttctaccgcctgcacttcaagatcccacagaccaatgtgtctgtggccatttttatgctggacacagtgacactatgtggcaactcagatgacttcctcagccagcagcctgagaggccccgagacgtgaagctggcccgcacacagctgtcctggctcaagaaacagctggcggcggccagggaggactacgtgctggtggctggccactaccccgtgtggtccatagccgagcacgggcctacccactgcctggtcaagcagctacggccactgctggccacatacggggtcactgcctacctgtgcggccacgatcacaatctgcagtacctgcaagatgagaatggcgtgggctacgtgctgagtggggctgggaatttcatggacccctcaaagcggcaccagcgcaaggtccccaacggctatctgcgcttccactatgggactgaagactcactgggtggctttgcctatgtggagatcagctccaaagagatgactgtcacttacatcgaggcctcgggcaagtccctctttaagaccaggctgccgaggcgagccaggccctga
Sequence Length
978
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
54
Molecular Weight
36,599 Da
NCBI Official Full Name
Homo sapiens acid phosphatase 5, tartrate resistant, mRNA
NCBI Official Synonym Full Names
acid phosphatase 5, tartrate resistant
NCBI Official Symbol
ACP5
NCBI Official Synonym Symbols
HPAP; TRAP; TRACP5a; TRACP5b; TrATPase
NCBI Protein Information
tartrate-resistant acid phosphatase type 5
UniProt Protein Name
Tartrate-resistant acid phosphatase type 5
Protein Family
UniProt Gene Name
ACP5
UniProt Synonym Gene Names
TR-AP; TrATPase
UniProt Entry Name
PPA5_HUMAN

NCBI Description

This gene encodes an iron containing glycoprotein which catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is the most basic of the acid phosphatases and is the only form not inhibited by L(+)-tartrate. [provided by RefSeq, Aug 2008]

Uniprot Description

ACP5: Involved in osteopontin/bone sialoprotein dephosphorylation. Its expression seems to increase in certain pathological states such as Gaucher and Hodgkin diseases, the hairy cell, the B-cell, and the T-cell leukemias. Defects in ACP5 are the cause of spondyloenchondrodysplasia with immune dysregulation (SPENCDI). A disease characterized by vertebral and metaphyseal dysplasia, spasticity with cerebral calcifications, and strong predisposition to autoimmune diseases. The skeletal dysplasia is characterized by radiolucent and irregular spondylar and metaphyseal lesions that represent islands of chondroid tissue within bone. ACP5 inactivating mutations result in a functional excess of phosphorylated osteopontin causing deregulation of osteopontin signaling and consequential autoimmune disease. Belongs to the metallophosphoesterase superfamily. Purple acid phosphatase family.

Protein type: Phosphatase; Motility/polarity/chemotaxis; EC 3.1.3.2; Cofactor and Vitamin Metabolism - riboflavin

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: cytosol; integral to membrane

Molecular Function: acid phosphatase activity; ferric iron binding; ferrous iron binding

Biological Process: riboflavin metabolic process

Disease: Spondyloenchondrodysplasia With Immune Dysregulation

Research Articles on ACP5

Similar Products

Product Notes

The ACP5 acp5 (Catalog #AAA1266586) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacatgt ggacggcgct gctcatcctg caagccttgt tgctaccctc cctggctgat ggtgccaccc ctgccctgcg ctttgtagcc gtgggtgact ggggaggggt ccccaatgcc ccattccaca cggcccggga aatggccaat gccaaggaga tcgctcggac tgtgcagatc ctgggtgcag acttcatcct gtctctaggg gacaattttt acttcactgg tgtgcaagac atcaatgaca agaggttcca ggagaccttt gaggacgtat tctctgaccg ctcccttcgc aaagtgccct ggtacgtgct agccggaaac catgaccacc ttggcaatgt ctctgcccag attgcatact ctaagatctc caagcgctgg aacttcccca gccctttcta ccgcctgcac ttcaagatcc cacagaccaa tgtgtctgtg gccattttta tgctggacac agtgacacta tgtggcaact cagatgactt cctcagccag cagcctgaga ggccccgaga cgtgaagctg gcccgcacac agctgtcctg gctcaagaaa cagctggcgg cggccaggga ggactacgtg ctggtggctg gccactaccc cgtgtggtcc atagccgagc acgggcctac ccactgcctg gtcaagcagc tacggccact gctggccaca tacggggtca ctgcctacct gtgcggccac gatcacaatc tgcagtacct gcaagatgag aatggcgtgg gctacgtgct gagtggggct gggaatttca tggacccctc aaagcggcac cagcgcaagg tccccaacgg ctatctgcgc ttccactatg ggactgaaga ctcactgggt ggctttgcct atgtggagat cagctccaaa gagatgactg tcacttacat cgaggcctcg ggcaagtccc tctttaagac caggctgccg aggcgagcca ggccctga. It is sometimes possible for the material contained within the vial of "ACP5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.