Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ACADSB cdna clone

ACADSB cDNA Clone

Gene Names
ACADSB; ACAD7; SBCAD; 2-MEBCAD
Synonyms
ACADSB; ACADSB cDNA Clone; ACADSB cdna clone
Ordering
For Research Use Only!
Sequence
atggagggcctggcagtgcggttgctgcgcggcagcaagctgctaagaagaaatttcctgacttgtttgtcttcttggaagattcctcctcatgtctcaaaatcttcccagtcagaagctctactcaatataacaaataatggaatacactttgctcccctgcaaacatttacagatgaggaaatgatgataaagagttcagttaaaaaatttgctcaggaacaaattgcacctttggtttcaaccatggatgaaaattcgaaaatggagaaatcagtaatacaaggattatttcaacaagggttgatgggtattgaagttgacccagaatatggaggcacaggagcttcatttttatccactgtgctcgtgatagaggaattagccaaagttgatgcatctgtggctgtcttttgtgagatccagaacacattaattaacacactgattagaaaacatggaacagaagaacaaaaggccacctatttgcctcagctcactacagaaaaagtaggaagtttctgcctttcagaggctggagcaggtagtgactcatttgctttgaagaccagagctgataaagagggagattattatgtcctcaatggatcaaagatgtggatcagcagtgctgagcacgcagggctctttctggtgatggcaaatgtagaccctaccattggatataagggaattacctccttcttagtagatcgtgatactccgggccttcatatagggaaacctgaaaacaaattggggctcagagcttcttccacctgcccgttaacattcgaaaatgtcaaggttccagaagccaatatcttgggacaaattggacatggctataagtatgccatagggagtctcaatgaaggtagaataggaattgctgcacagatgctgggactggcgcaaggatgttttgactacactattccatatattaaagaaaggatacaatttggcaaaagactatttgattttcagggcctccaacaccaagtggctcacgtggccacccagctggaagctgcaagattactaacatacaatgctgctaggcttttagaagctggaaagccattcataaaagaagcgtcaatggccaaatactatgcatcagagattgcaggacaaacaacgagtaaatgtatcgagtggatggggggagtaggctacaccaaagattaccctgtggagaaatacttccgagatgcaaagattggtacgatatatgaaggagcttccaacatccagttgaacaccattgcaaagcatatcgatgcagaatactga
Sequence Length
1299
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
36
Molecular Weight
36,025 Da
NCBI Official Full Name
Homo sapiens acyl-Coenzyme A dehydrogenase, short/branched chain, mRNA
NCBI Official Synonym Full Names
acyl-CoA dehydrogenase, short/branched chain
NCBI Official Symbol
ACADSB
NCBI Official Synonym Symbols
ACAD7; SBCAD; 2-MEBCAD
NCBI Protein Information
short/branched chain specific acyl-CoA dehydrogenase, mitochondrial
UniProt Protein Name
Short/branched chain specific acyl-CoA dehydrogenase, mitochondrial
UniProt Gene Name
ACADSB
UniProt Synonym Gene Names
SBCAD; 2-MEBCAD; 2-methylbutyryl-CoA dehydrogenase
UniProt Entry Name
ACDSB_HUMAN

NCBI Description

Short/branched chain acyl-CoA dehydrogenase(ACADSB) is a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. Substrate specificity is the primary characteristic used to define members of this gene family. The ACADSB gene product has the greatest activity towards the short branched chain acyl-CoA derivative, (S)-2-methylbutyryl-CoA, but also reacts significantly with other 2-methyl branched chain substrates and with short straight chain acyl-CoAs. The cDNA encodes for a mitochondrial precursor protein which is cleaved upon mitochondrial import and predicted to yield a mature peptide of approximately 43.7-KDa. [provided by RefSeq, Jul 2008]

Uniprot Description

ACADSB: Has greatest activity toward short branched chain acyl- CoA derivative such as (s)-2-methylbutyryl-CoA, isobutyryl-CoA, and 2-methylhexanoyl-CoA as well as toward short straight chain acyl-CoAs such as butyryl-CoA and hexanoyl-CoA. Can use valproyl- CoA as substrate and may play a role in controlling the metabolic flux of valproic acid in the development of toxicity of this agent. Defects in ACADSB are the cause of short/branched-chain acyl-CoA dehydrogenase deficiency (SBCADD); also known as 2-methylbutyryl-CoA dehydrogenase deficiency or 2- methylbutyryl glycinuria. SBCADD is an autosomal recessive disorder and consists of a defect in catabolism of L-isoleucine which is characterized by an increase of 2-methylbutyrylglycine and 2-methylbutyrylcarnitine in blood and urine. Affected individuals have seizures and psychomotor delay as the main clinical features. Belongs to the acyl-CoA dehydrogenase family.

Protein type: Amino Acid Metabolism - valine, leucine and isoleucine degradation; EC 1.3.8.5; Oxidoreductase; Mitochondrial; Lipid Metabolism - fatty acid

Chromosomal Location of Human Ortholog: 10q26.13

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: acyl-CoA binding; acyl-CoA dehydrogenase activity; electron carrier activity; FAD binding

Biological Process: branched chain family amino acid catabolic process; fatty acid beta-oxidation using acyl-CoA dehydrogenase; fatty acid metabolic process; lipid homeostasis

Disease: 2-methylbutyryl-coa Dehydrogenase Deficiency

Research Articles on ACADSB

Similar Products

Product Notes

The ACADSB acadsb (Catalog #AAA1266563) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggcc tggcagtgcg gttgctgcgc ggcagcaagc tgctaagaag aaatttcctg acttgtttgt cttcttggaa gattcctcct catgtctcaa aatcttccca gtcagaagct ctactcaata taacaaataa tggaatacac tttgctcccc tgcaaacatt tacagatgag gaaatgatga taaagagttc agttaaaaaa tttgctcagg aacaaattgc acctttggtt tcaaccatgg atgaaaattc gaaaatggag aaatcagtaa tacaaggatt atttcaacaa gggttgatgg gtattgaagt tgacccagaa tatggaggca caggagcttc atttttatcc actgtgctcg tgatagagga attagccaaa gttgatgcat ctgtggctgt cttttgtgag atccagaaca cattaattaa cacactgatt agaaaacatg gaacagaaga acaaaaggcc acctatttgc ctcagctcac tacagaaaaa gtaggaagtt tctgcctttc agaggctgga gcaggtagtg actcatttgc tttgaagacc agagctgata aagagggaga ttattatgtc ctcaatggat caaagatgtg gatcagcagt gctgagcacg cagggctctt tctggtgatg gcaaatgtag accctaccat tggatataag ggaattacct ccttcttagt agatcgtgat actccgggcc ttcatatagg gaaacctgaa aacaaattgg ggctcagagc ttcttccacc tgcccgttaa cattcgaaaa tgtcaaggtt ccagaagcca atatcttggg acaaattgga catggctata agtatgccat agggagtctc aatgaaggta gaataggaat tgctgcacag atgctgggac tggcgcaagg atgttttgac tacactattc catatattaa agaaaggata caatttggca aaagactatt tgattttcag ggcctccaac accaagtggc tcacgtggcc acccagctgg aagctgcaag attactaaca tacaatgctg ctaggctttt agaagctgga aagccattca taaaagaagc gtcaatggcc aaatactatg catcagagat tgcaggacaa acaacgagta aatgtatcga gtggatgggg ggagtaggct acaccaaaga ttaccctgtg gagaaatact tccgagatgc aaagattggt acgatatatg aaggagcttc caacatccag ttgaacacca ttgcaaagca tatcgatgca gaatactga. It is sometimes possible for the material contained within the vial of "ACADSB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.