Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCK1 cdna clone

NCK1 cDNA Clone

Gene Names
NCK1; NCK; nck-1; NCKalpha
Synonyms
NCK1; NCK1 cDNA Clone; NCK1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagaagaagtggtggtagtagccaaatttgattatgtggcccaacaagaacaagagttggacatcaagaagaatgagagattatggcttctggatgattctaagtcctggtggcgagttcgaaattccatgaataaaacaggttttgtgccttctaactatgtggaaaggaaaaacagtgctcggaaagcatctattgtgaaaaacctaaaggataccttaggcattggaaaagtgaaaagaaaacctagtgtgccagattctgcatctcctgctgatgatagttttgttgacccaggggaacgtctctatgacctcaacatgcccgcttatgtgaaatttaactacatggctgagagagaggatgaattatcattgataaaggggacaaaggtgatcgtcatggagaaatgcagtgatgggtggtggcgtggtagctacaatggacaagttggatggttcccttcaaactatgtaactgaagaaggtgacagtcctttgggtgaccatgtgggttctctgtcagagaaattagcagcagtcgtcaataacctaaatactgggcaagtgttgcatgtggtacaggctctttacccattcagctcatctaatgatgaagaacttaatttcgagaaaggagatgtaatggatgttattgaaaaacctgaaaatgacccagagtggtggaaatgcaggaagatcaatggtatggttggtctagtaccaaaaaactatgttaccgttatgcagaataatccattaacttcaggtttggaaccatcacctccacagtgtgattacattaggccttcactcactggaaagtttgctggcaatccttggtattatggcaaagtcaccaggcatcaagcagaaatggcattaaatgaaagaggacatgaaggggatttcctcattcgtgatagtgaatcttcgccaaatgatttctcagtatcactaaaagcacaagggaaaaacaagcattttaaagtccaactaaaagagactgtctactgcattgggcagcgtaaattcagcaccatggaagaacttgtagaacattacaaaaaggcaccaatttttacaagtgaacaaggagaaaaattatatcttgtcaagcatttatcatga
Sequence Length
1134
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,511 Da
NCBI Official Full Name
Homo sapiens NCK adaptor protein 1, mRNA
NCBI Official Synonym Full Names
NCK adaptor protein 1
NCBI Official Symbol
NCK1
NCBI Official Synonym Symbols
NCK; nck-1; NCKalpha
NCBI Protein Information
cytoplasmic protein NCK1
UniProt Protein Name
Cytoplasmic protein NCK1
Protein Family
UniProt Gene Name
NCK1
UniProt Synonym Gene Names
NCK; Nck-1
UniProt Entry Name
NCK1_HUMAN

NCBI Description

The protein encoded by this gene is one of the signaling and transforming proteins containing Src homology 2 and 3 (SH2 and SH3) domains. It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as RAS. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jun 2010]

Uniprot Description

NCK1: adapter protein containing Src homology 2 and 3 (SH2 and SH3) domains. Transduces signals from tyrosine-phosphorylated growth factor receptors to their cellular substrates.

Protein type: Motility/polarity/chemotaxis; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 3q21

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; endoplasmic reticulum; plasma membrane; protein phosphatase type 1 complex; ribosome; trans-Golgi network

Molecular Function: ARF guanyl-nucleotide exchange factor activity; protein binding; protein binding, bridging; protein kinase inhibitor activity; receptor binding; receptor tyrosine kinase binding

Biological Process: negative regulation of peptidyl-serine phosphorylation; positive regulation of actin filament polymerization; positive regulation of T cell proliferation; positive regulation of transcription from RNA polymerase II promoter; T cell activation; T cell receptor signaling pathway; vascular endothelial growth factor receptor signaling pathway; vesicle-mediated transport

Research Articles on NCK1

Similar Products

Product Notes

The NCK1 nck1 (Catalog #AAA1266491) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaag aagtggtggt agtagccaaa tttgattatg tggcccaaca agaacaagag ttggacatca agaagaatga gagattatgg cttctggatg attctaagtc ctggtggcga gttcgaaatt ccatgaataa aacaggtttt gtgccttcta actatgtgga aaggaaaaac agtgctcgga aagcatctat tgtgaaaaac ctaaaggata ccttaggcat tggaaaagtg aaaagaaaac ctagtgtgcc agattctgca tctcctgctg atgatagttt tgttgaccca ggggaacgtc tctatgacct caacatgccc gcttatgtga aatttaacta catggctgag agagaggatg aattatcatt gataaagggg acaaaggtga tcgtcatgga gaaatgcagt gatgggtggt ggcgtggtag ctacaatgga caagttggat ggttcccttc aaactatgta actgaagaag gtgacagtcc tttgggtgac catgtgggtt ctctgtcaga gaaattagca gcagtcgtca ataacctaaa tactgggcaa gtgttgcatg tggtacaggc tctttaccca ttcagctcat ctaatgatga agaacttaat ttcgagaaag gagatgtaat ggatgttatt gaaaaacctg aaaatgaccc agagtggtgg aaatgcagga agatcaatgg tatggttggt ctagtaccaa aaaactatgt taccgttatg cagaataatc cattaacttc aggtttggaa ccatcacctc cacagtgtga ttacattagg ccttcactca ctggaaagtt tgctggcaat ccttggtatt atggcaaagt caccaggcat caagcagaaa tggcattaaa tgaaagagga catgaagggg atttcctcat tcgtgatagt gaatcttcgc caaatgattt ctcagtatca ctaaaagcac aagggaaaaa caagcatttt aaagtccaac taaaagagac tgtctactgc attgggcagc gtaaattcag caccatggaa gaacttgtag aacattacaa aaaggcacca atttttacaa gtgaacaagg agaaaaatta tatcttgtca agcatttatc atga. It is sometimes possible for the material contained within the vial of "NCK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.