Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FPR2 cdna clone

FPR2 cDNA Clone

Gene Names
FPR2; ALXR; HM63; FMLPX; FPR2A; FPRH1; FPRH2; FPRL1; LXA4R; FMLP-R-II
Synonyms
FPR2; FPR2 cDNA Clone; FPR2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaaccaacttctccactcctctgaatgaatatgaagaagtgtcctatgagtctgctggctacactgttctgcggatcctcccattggtggtgcttggggtcacctttgtcctcggggtcctgggcaatgggcttgtgatctgggtggctggattccggatgacacgcacagtcaccaccatctgttacctgaacctggccctggctgacttttctttcacggccacattaccattcctcattgtctccatggccatgggagaaaaatggccttttggctggttcctgtgtaagttaattcacatcgtggtggacatcaacctctttggaagtgtcttcttgattggtttcattgcactggaccgctgcatttgtgtcctgcatccagtctgggcccagaaccaccgcactgtgagtctggccatgaaggtgatcgtcggaccttggattcttgctctagtccttaccttgccagttttcctctttttgactacagtaactattccaaatggggacacatactgtactttcaactttgcatcctggggtggcacccctgaggagaggctgaaggtggccattaccatgctgacagccagagggattatccggtttgtcattggctttagcttgccgatgtccattgttgccatctgctatgggctcattgcagccaagatccacaaaaagggcatgattaaatccagccgtcccttacgggtcctcactgctgtggtggcttctttcttcatctgttggtttccctttcaactggttgcccttctgggcaccgtctggctcaaagagatgttgttctatggcaagtacaaaatcattgacatcctggttaacccaacgagctccctggccttcttcaacagctgcctcaaccccatgctttacgtctttgtgggccaagacttccgagagagactgatccactccctgcccaccagtctggagagggccctgtctgaggactcagccccaactaatgacacggctgccaattctgcttcacctcctgcagagactgagttacaggcaatgtga
Sequence Length
1056
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,964 Da
NCBI Official Full Name
Homo sapiens formyl peptide receptor 2, mRNA
NCBI Official Synonym Full Names
formyl peptide receptor 2
NCBI Official Symbol
FPR2
NCBI Official Synonym Symbols
ALXR; HM63; FMLPX; FPR2A; FPRH1; FPRH2; FPRL1; LXA4R; FMLP-R-II
NCBI Protein Information
N-formyl peptide receptor 2
UniProt Protein Name
N-formyl peptide receptor 2
Protein Family
UniProt Gene Name
FPR2
UniProt Synonym Gene Names
FPRH1; FPRL1; LXA4R; FMLP-R-I; LXA4 receptor
UniProt Entry Name
FPR2_HUMAN

Uniprot Description

FPR2: Low affinity receptor for N-formyl-methionyl peptides, which are powerful neutrophils chemotactic factors. Binding of FMLP to the receptor causes activation of neutrophils. This response is mediated via a G-protein that activates a phosphatidylinositol-calcium second messenger system. The activation of LXA4R could result in an anti-inflammatory outcome counteracting the actions of proinflammatory signals such as LTB4 (leukotriene B4). Belongs to the G-protein coupled receptor 1 family.

Protein type: GPCR, family 1; Receptor, GPCR; Membrane protein, multi-pass; Membrane protein, integral; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19q13.3-q13.4

Cellular Component: plasma membrane

Molecular Function: G-protein coupled receptor activity

Biological Process: cell adhesion; cell motility; inflammatory response

Research Articles on FPR2

Similar Products

Product Notes

The FPR2 fpr2 (Catalog #AAA1266438) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaacca acttctccac tcctctgaat gaatatgaag aagtgtccta tgagtctgct ggctacactg ttctgcggat cctcccattg gtggtgcttg gggtcacctt tgtcctcggg gtcctgggca atgggcttgt gatctgggtg gctggattcc ggatgacacg cacagtcacc accatctgtt acctgaacct ggccctggct gacttttctt tcacggccac attaccattc ctcattgtct ccatggccat gggagaaaaa tggccttttg gctggttcct gtgtaagtta attcacatcg tggtggacat caacctcttt ggaagtgtct tcttgattgg tttcattgca ctggaccgct gcatttgtgt cctgcatcca gtctgggccc agaaccaccg cactgtgagt ctggccatga aggtgatcgt cggaccttgg attcttgctc tagtccttac cttgccagtt ttcctctttt tgactacagt aactattcca aatggggaca catactgtac tttcaacttt gcatcctggg gtggcacccc tgaggagagg ctgaaggtgg ccattaccat gctgacagcc agagggatta tccggtttgt cattggcttt agcttgccga tgtccattgt tgccatctgc tatgggctca ttgcagccaa gatccacaaa aagggcatga ttaaatccag ccgtccctta cgggtcctca ctgctgtggt ggcttctttc ttcatctgtt ggtttccctt tcaactggtt gcccttctgg gcaccgtctg gctcaaagag atgttgttct atggcaagta caaaatcatt gacatcctgg ttaacccaac gagctccctg gccttcttca acagctgcct caaccccatg ctttacgtct ttgtgggcca agacttccga gagagactga tccactccct gcccaccagt ctggagaggg ccctgtctga ggactcagcc ccaactaatg acacggctgc caattctgct tcacctcctg cagagactga gttacaggca atgtga. It is sometimes possible for the material contained within the vial of "FPR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.