Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAD18 cdna clone

RAD18 cDNA Clone

Gene Names
RAD18; RNF73
Synonyms
RAD18; RAD18 cDNA Clone; RAD18 cdna clone
Ordering
For Research Use Only!
Sequence
atggactccctggccgagtctcggtggcctccgggcctggcagtcatgaagacaatagatgatttgctgcggtgtggaatttgcttcgagtatttcaacattgcaatgataatacctcagtgttcacataactactgctctctctgtataagaaaatttctgtcctataaaactcagtgtccaacttgctgtgtgactgtcacagagccggatctgaaaaataaccgcatattagatgaactggtaaaaagcttgaattttgcacggaatcatctgctgcagtttgctttagagtcaccagccaaatctcctgcttcttcctcttcaaagaatcttgctgtcaaagtatatactcctgtagcctccagacagtctttaaagcaggggagcaggttaatggataatttcttgatcagagaaatgagtggttctacatcagagttgttgataaaagaaaataaaagcaaattcagccctcaaaaagaggcgagccctgctgcaaagaccaaagagacacgttctgtagaagagatcgctccagatccctcagaggctaagcgtcctgagccaccctcgacatccactttgaaacaagttactaaagtggattgtcctgtttgcggggttaacattccagaaagtcacattaataagcatttagacagctgtttatcacgcgaagagaagaaggaaagcctcagaagttctgttcacaaaaggaagccgctgcccaaaactgtatataatttgctctctgatcgtgatttaaagaaaaagctaaaagagcatggattatctattcaaggaaataaacaacagctcattaaaaggcaccaagaatttgtacacatgtacaatgcccaatgcgatgctttgcatcctaaatcagctgctgaaatagttcaagaaatcgaaaatatagagaagactaggatgcgtcttgaagctagtaaactcaatgaaagtgtaatggtttttacaaaggaccaaacagaaaaggaaatagatgaaatccacagtaaatatcgtaaaaaacataagagtgaatttcagcttctggtggatcaggctagaaaaggatacaagaaaattgctggaatgtcacaaaaaacagtaacaataacaaaagaagatgaatctacagaaaagctatcttctgtatgcatgggacaggaagataatatgacctcagtaacaaaccacttttctcaatcaaagctggactccccagaggaattggaacctgacagagaagaggattcttctagctgtattgatattcaagaagttctttcttcatcagaatcagattcatgcaatagttccagttcagacatcataagagatcttttagaagaagaggaagcctgggaagcatcacataaaaacgatcttcaagacacagaaataagtccaagacagaatcgccgcacaagagccgctgaaagtgctgagattgaaccaagaaacaagcgtaataggaattaa
Sequence Length
1488
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,223 Da
NCBI Official Full Name
Homo sapiens RAD18 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
RAD18, E3 ubiquitin protein ligase
NCBI Official Symbol
RAD18
NCBI Official Synonym Symbols
RNF73
NCBI Protein Information
E3 ubiquitin-protein ligase RAD18
UniProt Protein Name
E3 ubiquitin-protein ligase RAD18
UniProt Gene Name
RAD18
UniProt Synonym Gene Names
RNF73; hHR18; hRAD18
UniProt Entry Name
RAD18_HUMAN

NCBI Description

The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]

Uniprot Description

RAD18: a structural maintenance of chromosomes (SMC) protein involved in postreplication repair of UV-damaged DNA. Has ssDNA binding activity. Interacts with Rad6 through a conserved ring-finger motif. Rad6 is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Postreplication repair functions in gap-filling of a daughter strand on replication of damaged DNA.

Protein type: EC 6.3.2.19; DNA repair, damage; EC 6.3.2.-; Ligase; Ubiquitin conjugating system; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 3p25.3

Cellular Component: centrosome; nuclear inclusion body; nucleoplasm; nucleus; replication fork

Molecular Function: identical protein binding; polyubiquitin binding; protein binding; protein complex binding; single-stranded DNA-dependent ATPase activity; ubiquitin protein ligase binding; Y-form DNA binding

Biological Process: DNA damage response, detection of DNA damage; positive regulation of chromosome segregation; postreplication repair; protein autoubiquitination; protein monoubiquitination; response to DNA damage stimulus; response to UV

Research Articles on RAD18

Similar Products

Product Notes

The RAD18 rad18 (Catalog #AAA1266436) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactccc tggccgagtc tcggtggcct ccgggcctgg cagtcatgaa gacaatagat gatttgctgc ggtgtggaat ttgcttcgag tatttcaaca ttgcaatgat aatacctcag tgttcacata actactgctc tctctgtata agaaaatttc tgtcctataa aactcagtgt ccaacttgct gtgtgactgt cacagagccg gatctgaaaa ataaccgcat attagatgaa ctggtaaaaa gcttgaattt tgcacggaat catctgctgc agtttgcttt agagtcacca gccaaatctc ctgcttcttc ctcttcaaag aatcttgctg tcaaagtata tactcctgta gcctccagac agtctttaaa gcaggggagc aggttaatgg ataatttctt gatcagagaa atgagtggtt ctacatcaga gttgttgata aaagaaaata aaagcaaatt cagccctcaa aaagaggcga gccctgctgc aaagaccaaa gagacacgtt ctgtagaaga gatcgctcca gatccctcag aggctaagcg tcctgagcca ccctcgacat ccactttgaa acaagttact aaagtggatt gtcctgtttg cggggttaac attccagaaa gtcacattaa taagcattta gacagctgtt tatcacgcga agagaagaag gaaagcctca gaagttctgt tcacaaaagg aagccgctgc ccaaaactgt atataatttg ctctctgatc gtgatttaaa gaaaaagcta aaagagcatg gattatctat tcaaggaaat aaacaacagc tcattaaaag gcaccaagaa tttgtacaca tgtacaatgc ccaatgcgat gctttgcatc ctaaatcagc tgctgaaata gttcaagaaa tcgaaaatat agagaagact aggatgcgtc ttgaagctag taaactcaat gaaagtgtaa tggtttttac aaaggaccaa acagaaaagg aaatagatga aatccacagt aaatatcgta aaaaacataa gagtgaattt cagcttctgg tggatcaggc tagaaaagga tacaagaaaa ttgctggaat gtcacaaaaa acagtaacaa taacaaaaga agatgaatct acagaaaagc tatcttctgt atgcatggga caggaagata atatgacctc agtaacaaac cacttttctc aatcaaagct ggactcccca gaggaattgg aacctgacag agaagaggat tcttctagct gtattgatat tcaagaagtt ctttcttcat cagaatcaga ttcatgcaat agttccagtt cagacatcat aagagatctt ttagaagaag aggaagcctg ggaagcatca cataaaaacg atcttcaaga cacagaaata agtccaagac agaatcgccg cacaagagcc gctgaaagtg ctgagattga accaagaaac aagcgtaata ggaattaa. It is sometimes possible for the material contained within the vial of "RAD18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.