Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CPA2 cdna clone

CPA2 cDNA Clone

Synonyms
CPA2; CPA2 cDNA Clone; CPA2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggttgatcctgttttttggtgccctttttgggcatatctactgtctagaaacatttgtgggagaccaagttcttgagattgtaccaagcaatgaagaacaaattaaaaatctgctacaattggaggctcaagaacatctccagcttgatttttggaaatcacccaccaccccaggggagacagcccacgtccgagttcccttcgtcaacgtccaggcagtcaaagtgttcttggggtcccagggaattgcctattccatcatgattgaagacgtgcaggtcctgttggacaaagagaatgaagaaatgctttttaataggagaagagaacggagtggtaacttcaattttggggcctaccataccctggaagagatttcccaagaaatggataacctcgtggctgagcaccctggtctagtgagcaaagtgaatattggctcttcttttgagaaccggcctatgaacgtgctcaagttcagcaccggaggagacaagccagctatctggctggatgctgggatccatgctcgagagtgggttacacaagctacggcactttggacagcaaataagattgtttctgattatggaaaggacccatccatcacttccattctggacgccctggatatcttcctcctgccagtcacaaaccctgatggatacgtgttctctcaaaccaaaaatcgtatgtggcggaagacccggtccaaggtatctggaagcctctgtgttggtgtggatcctaaccggaactgggatgcaggttttggaggacctggagccagcagcaacccttgctctgattcataccacggacccagtgccaactctgaagttgaagtgaaatccatagtggacttcatcaagagtcatggaaaagtcaaggccttcattaccctccacagctattcccagctgctgatgttcccctatgggtacaaatgtaccaagttagatgactttgatgagctgagtgaagtggcccaaaaggctgcccaatctctgagaagcctgcatggcaccaagtacaaagtgggaccaatctgctctgtcatctaccaagccagtggaggaagcattgactggtcctatgattatggcatcaagtactcatttgcctttgaactgagagacacagggcgctacggcttcctcttgccagcccgtcagatcctgcccacagccgaggagacctggcttggcttgaaggcaatcatggagcatgtgcgagaccacccctattag
Sequence Length
1254
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,030 Da
NCBI Official Full Name
Homo sapiens carboxypeptidase A2 (pancreatic), mRNA
NCBI Official Synonym Full Names
carboxypeptidase A2
NCBI Official Symbol
CPA2
NCBI Protein Information
carboxypeptidase A2
UniProt Protein Name
Carboxypeptidase A2
Protein Family
UniProt Gene Name
CPA2
UniProt Entry Name
CBPA2_HUMAN

NCBI Description

Three different forms of human pancreatic procarboxypeptidase A have been isolated. The encoded protein represents the A2 form, which is a monomeric protein with different biochemical properties from the A1 and A3 forms. The A2 form of pancreatic procarboxypeptidase acts on aromatic C-terminal residues and is a secreted protein. [provided by RefSeq, Dec 2008]

Uniprot Description

CPA2: Three different forms of human pancreatic procarboxypeptidase A have been isolated. The encoded protein represents the A2 form, which is a monomeric protein with different biochemical properties from the A1 and A3 forms. The A2 form of pancreatic procarboxypeptidase acts on aromatic C-terminal residues and is a secreted protein. [provided by RefSeq, Dec 2008]

Protein type: Protease; Secreted; EC 3.4.17.15; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 7q32

Cellular Component: extracellular region; extracellular space

Molecular Function: carboxypeptidase activity; metallocarboxypeptidase activity; zinc ion binding

Biological Process: vacuolar protein catabolic process

Research Articles on CPA2

Similar Products

Product Notes

The CPA2 cpa2 (Catalog #AAA1266362) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggttga tcctgttttt tggtgccctt tttgggcata tctactgtct agaaacattt gtgggagacc aagttcttga gattgtacca agcaatgaag aacaaattaa aaatctgcta caattggagg ctcaagaaca tctccagctt gatttttgga aatcacccac caccccaggg gagacagccc acgtccgagt tcccttcgtc aacgtccagg cagtcaaagt gttcttgggg tcccagggaa ttgcctattc catcatgatt gaagacgtgc aggtcctgtt ggacaaagag aatgaagaaa tgctttttaa taggagaaga gaacggagtg gtaacttcaa ttttggggcc taccataccc tggaagagat ttcccaagaa atggataacc tcgtggctga gcaccctggt ctagtgagca aagtgaatat tggctcttct tttgagaacc ggcctatgaa cgtgctcaag ttcagcaccg gaggagacaa gccagctatc tggctggatg ctgggatcca tgctcgagag tgggttacac aagctacggc actttggaca gcaaataaga ttgtttctga ttatggaaag gacccatcca tcacttccat tctggacgcc ctggatatct tcctcctgcc agtcacaaac cctgatggat acgtgttctc tcaaaccaaa aatcgtatgt ggcggaagac ccggtccaag gtatctggaa gcctctgtgt tggtgtggat cctaaccgga actgggatgc aggttttgga ggacctggag ccagcagcaa cccttgctct gattcatacc acggacccag tgccaactct gaagttgaag tgaaatccat agtggacttc atcaagagtc atggaaaagt caaggccttc attaccctcc acagctattc ccagctgctg atgttcccct atgggtacaa atgtaccaag ttagatgact ttgatgagct gagtgaagtg gcccaaaagg ctgcccaatc tctgagaagc ctgcatggca ccaagtacaa agtgggacca atctgctctg tcatctacca agccagtgga ggaagcattg actggtccta tgattatggc atcaagtact catttgcctt tgaactgaga gacacagggc gctacggctt cctcttgcca gcccgtcaga tcctgcccac agccgaggag acctggcttg gcttgaaggc aatcatggag catgtgcgag accaccccta ttag. It is sometimes possible for the material contained within the vial of "CPA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.