Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AHCYL1 cdna clone

AHCYL1 cDNA Clone

Gene Names
AHCYL1; DCAL; IRBIT; PPP1R78; PRO0233; XPVKONA
Synonyms
AHCYL1; AHCYL1 cDNA Clone; AHCYL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaccgtcaccaaggcgcccaagaagcaaatccagtttgctgatgacatgcaggagttcaccaaattccccaccaaaactggccgaagatctttgtctcgctcgatctcacagtcctccactgacagctacagttcagctgcatcctacacagatagctctgatgatgaggtttctccccgagagaagcagcaaaccaactccaagggcagcagcaatttctgtgtgaagaacatcaagcaggcagaatttggacgccgggagattgagattgcagagcaagacatgtctgctctgatttcactcaggaaacgtgctcagggggagaagcccttggctggtgctaaaatagtgggctgtacacacatcacagcccagacagcggtgttgattgagacactctgtgccctgggggctcagtgccgctggtctgcttgtaacatctactcaactcagaatgaagtagctgcagcactggctgaggctggagttgcagtgttcgcttggaagggcgagtcagaagatgacttctggtggtgtattgaccgctgtgtgaacatggatgggtggcaggccaacatgatcctggatgatgggggagacttaacccactgggtttataagaagtatccaaacgtgtttaagaagatccgaggcattgtggaagagagcgtgactggtgttcacaggctgtatcagctctccaaagctgggaagctctgtgttccggccatgaacgtcaatgattctgttaccaaacagaagtttgataacttgtactgctgccgagaatccattttggatggcctgaagaggaccacagatgtgatgtttggtgggaaacaagtggtggtgtgtggctatggtgaggtaggcaagggctgctgtgctgctctcaaagctcttggagcaattgtctacattaccgaaatcgaccccatctgtgctctgcaggcctgcatggatgggttcagggtggtaaagctaaatgaagtcatccggcaagtcgatgtcgtaataacttgcacaggaaataagaatgtagtgacacgggagcacttggatcgcatgaaaaacagttgtatcgtatgcaatatgggccactccaacacagaaatcgatgtgaccagcctccgcactccggagctgacgtgggagcgagtacgttctcaggtggaccatgtcatctggccagatggcaaacgagttgtcctcctggcagagggtcgtctactcaatttgagctgctccacagttcccacctttgttctgtccatcacagccacaacacaggctttggcactgatagaactctataatgcacccgaggggcgatacaagcaggatgtgtacttgcttcctaagaaaatggatgaatacgttgccagcttgcatctgccatcatttgatgcccaccttacagagctgacagatgaccaagcaaaatatctgggactcaacaaaaatgggccattcaaacctaattattacagatactaa
Sequence Length
1503
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,753 Da
NCBI Official Full Name
Homo sapiens S-adenosylhomocysteine hydrolase-like 1, mRNA
NCBI Official Synonym Full Names
adenosylhomocysteinase like 1
NCBI Official Symbol
AHCYL1
NCBI Official Synonym Symbols
DCAL; IRBIT; PPP1R78; PRO0233; XPVKONA
NCBI Protein Information
adenosylhomocysteinase 2
UniProt Protein Name
Adenosylhomocysteinase 2
Protein Family
UniProt Gene Name
AHCYL1
UniProt Synonym Gene Names
AdoHcyase 2; IRBIT
UniProt Entry Name
SAHH2_HUMAN

NCBI Description

The protein encoded by this gene interacts with inositol 1,4,5-trisphosphate receptor, type 1 and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]

Uniprot Description

AHCYL1: an inositol 1,4,5-trisphosphate receptor 1 (IP3R1)-binding protein that inhibits IP3 binding to IP3R1 and IP3-induced intracellular Ca2 release. Suppresses the activation of IP3R1 via a phosphorylation-dependent mechanism. Also binds the Na/HCO3 cotransporter 1 (SLC4A4) and may play an important role in pH regulation. Contains a domain homologous to S-adenosylhomocysteine hydrolase (SAHH), although it is reported to possess no hydrolase activity. Its expression is induced in cultured monocytes when they are differentiated into dendritic cells (DC) by exposure to GM-CSF and IL-4.

Protein type: Other Amino Acids Metabolism - selenoamino acid; Amino Acid Metabolism - cysteine and methionine; EC 3.3.1.1; Hydrolase

Chromosomal Location of Human Ortholog: 1p13.2

Cellular Component: apical plasma membrane; cytoplasm; cytosol; endoplasmic reticulum membrane

Molecular Function: adenosylhomocysteinase activity; protein binding

Biological Process: mRNA polyadenylation; regulation of ion transmembrane transporter activity; regulation of mRNA 3'-end processing; response to calcium ion; S-adenosylmethionine cycle

Research Articles on AHCYL1

Similar Products

Product Notes

The AHCYL1 ahcyl1 (Catalog #AAA1266320) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaccg tcaccaaggc gcccaagaag caaatccagt ttgctgatga catgcaggag ttcaccaaat tccccaccaa aactggccga agatctttgt ctcgctcgat ctcacagtcc tccactgaca gctacagttc agctgcatcc tacacagata gctctgatga tgaggtttct ccccgagaga agcagcaaac caactccaag ggcagcagca atttctgtgt gaagaacatc aagcaggcag aatttggacg ccgggagatt gagattgcag agcaagacat gtctgctctg atttcactca ggaaacgtgc tcagggggag aagcccttgg ctggtgctaa aatagtgggc tgtacacaca tcacagccca gacagcggtg ttgattgaga cactctgtgc cctgggggct cagtgccgct ggtctgcttg taacatctac tcaactcaga atgaagtagc tgcagcactg gctgaggctg gagttgcagt gttcgcttgg aagggcgagt cagaagatga cttctggtgg tgtattgacc gctgtgtgaa catggatggg tggcaggcca acatgatcct ggatgatggg ggagacttaa cccactgggt ttataagaag tatccaaacg tgtttaagaa gatccgaggc attgtggaag agagcgtgac tggtgttcac aggctgtatc agctctccaa agctgggaag ctctgtgttc cggccatgaa cgtcaatgat tctgttacca aacagaagtt tgataacttg tactgctgcc gagaatccat tttggatggc ctgaagagga ccacagatgt gatgtttggt gggaaacaag tggtggtgtg tggctatggt gaggtaggca agggctgctg tgctgctctc aaagctcttg gagcaattgt ctacattacc gaaatcgacc ccatctgtgc tctgcaggcc tgcatggatg ggttcagggt ggtaaagcta aatgaagtca tccggcaagt cgatgtcgta ataacttgca caggaaataa gaatgtagtg acacgggagc acttggatcg catgaaaaac agttgtatcg tatgcaatat gggccactcc aacacagaaa tcgatgtgac cagcctccgc actccggagc tgacgtggga gcgagtacgt tctcaggtgg accatgtcat ctggccagat ggcaaacgag ttgtcctcct ggcagagggt cgtctactca atttgagctg ctccacagtt cccacctttg ttctgtccat cacagccaca acacaggctt tggcactgat agaactctat aatgcacccg aggggcgata caagcaggat gtgtacttgc ttcctaagaa aatggatgaa tacgttgcca gcttgcatct gccatcattt gatgcccacc ttacagagct gacagatgac caagcaaaat atctgggact caacaaaaat gggccattca aacctaatta ttacagatac taa. It is sometimes possible for the material contained within the vial of "AHCYL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.