Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SUV39H2 cdna clone

SUV39H2 cDNA Clone

Gene Names
SUV39H2; KMT1B
Synonyms
SUV39H2; SUV39H2 cDNA Clone; SUV39H2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggtcggggccgaggcgcgaggagcttggtgtgtgccttgcctagtttcacttgatactcttcaggaattatgtagaaaagaaaagctcacatgtaaatcgattggaatcaccaaaaggaatctaaacaattatgaggtggaatacttgtgtgactacaaggtagtaaaggatatggaatattatcttgtaaaatggaaaggatggccagattctacaaatacttgggaacctttgcaaaatctgaagtgcccgttactgcttcagcaattctctaatgacaagcataattatttatctcaggtaatcacaagtgaagaagctgaaagacgaggacagttctatgacaacaagggaatcacgtatctctttgatctggactatgagtctgatgaattcacagtggatgcggctcgatacggcaatgtgtctcattttgtgaatcacagctgtgacccaaatcttcaggtgttcaatgttttcattgataacctcgatactcgtcttccccgaatagcattgttttccacaagaaccataaatgctggagaagagctgacttttgattatcaaatgaaaggttctggagatatatcttcagattctattgaccacagcccagccaaaaagagggtcagaacagtatgtaaatgtggagctgtgacttgcagaggttacctcaactga
Sequence Length
693
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,350 Da
NCBI Official Full Name
Homo sapiens suppressor of variegation 3-9 homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
suppressor of variegation 3-9 homolog 2
NCBI Official Symbol
SUV39H2
NCBI Official Synonym Symbols
KMT1B
NCBI Protein Information
histone-lysine N-methyltransferase SUV39H2
UniProt Protein Name
Histone-lysine N-methyltransferase SUV39H2
UniProt Gene Name
SUV39H2
UniProt Synonym Gene Names
KMT1B; H3-K9-HMTase 2; Su(var)3-9 homolog 2
UniProt Entry Name
SUV92_HUMAN

Uniprot Description

SUV39H2: Histone methyltransferase that specifically trimethylates 'Lys-9' of histone H3 using monomethylated H3 'Lys- 9' as substrate. H3 'Lys-9' trimethylation represents a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Mainly functions in heterochromatin regions, thereby playing a central role in the establishment of constitutive heterochromatin at pericentric and telomere regions. H3 'Lys-9' trimethylation is also required to direct DNA methylation at pericentric repeats. SUV39H1 is targeted to histone H3 via its interaction with RB1 and is involved in many processes, such as cell cycle regulation, transcriptional repression and regulation of telomere length. May participate in regulation of higher-order chromatin organization during spermatogenesis. Belongs to the histone-lysine methyltransferase family. Suvar3-9 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.1.1.43; Methyltransferase; Methyltransferase, protein lysine; Amino Acid Metabolism - lysine degradation

Chromosomal Location of Human Ortholog: 10p13

Cellular Component: chromatin; nucleoplasm

Molecular Function: histone lysine N-methyltransferase activity (H3-K9 specific); histone-lysine N-methyltransferase activity; protein binding

Biological Process: chromatin assembly or disassembly; chromatin remodeling; negative regulation of circadian rhythm; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent

Research Articles on SUV39H2

Similar Products

Product Notes

The SUV39H2 suv39h2 (Catalog #AAA1266266) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg tcggggccga ggcgcgagga gcttggtgtg tgccttgcct agtttcactt gatactcttc aggaattatg tagaaaagaa aagctcacat gtaaatcgat tggaatcacc aaaaggaatc taaacaatta tgaggtggaa tacttgtgtg actacaaggt agtaaaggat atggaatatt atcttgtaaa atggaaagga tggccagatt ctacaaatac ttgggaacct ttgcaaaatc tgaagtgccc gttactgctt cagcaattct ctaatgacaa gcataattat ttatctcagg taatcacaag tgaagaagct gaaagacgag gacagttcta tgacaacaag ggaatcacgt atctctttga tctggactat gagtctgatg aattcacagt ggatgcggct cgatacggca atgtgtctca ttttgtgaat cacagctgtg acccaaatct tcaggtgttc aatgttttca ttgataacct cgatactcgt cttccccgaa tagcattgtt ttccacaaga accataaatg ctggagaaga gctgactttt gattatcaaa tgaaaggttc tggagatata tcttcagatt ctattgacca cagcccagcc aaaaagaggg tcagaacagt atgtaaatgt ggagctgtga cttgcagagg ttacctcaac tga. It is sometimes possible for the material contained within the vial of "SUV39H2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.