Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CTSO cdna clone

CTSO cDNA Clone

Gene Names
CTSO; CTSO1
Synonyms
CTSO; CTSO cDNA Clone; CTSO cdna clone
Ordering
For Research Use Only!
Sequence
atggacgtgcgggcgctgccgtggctgccgtggctgctgtggctgctgtgccggggcggcggcgatgcggactcccgcgcccccttcaccccgacctggccgcggagccgcgagcgtgaagccgccgccttccgggaaagtcttaatagacatcgatacttgaattctttatttcccagtgaaaactccaccgccttctatggaataaatcagttttcctatttgtttcctgaagagtttaaagccatttatttaagaagcaaaccttccaagtttcccagatactcagcagaagtacatatgtccatccccaatgtgtctttgccgttaagatttgactggagggacaagcaggttgtgacacaagtgagaaaccagcagatgtgtggaggatgctgggccttcagcgtggtgggggcagtggaatctgcttatgcaataaaggggaagcccctggaagacctaagtgtccagcaggtcattgactgttcgtataataattatggctgcaatggaggctctactctcaatgctttgaactggttaaacaagatgcaagtaaaactggtgaaagattcagaatatccttttaaagcacaaaatggtctgtgccattacttttctggttcacattctggattttcaatcaaaggttattctgcatatgacttcagtgaccaagaagatgaaatggcaaaagcacttcttacctttggccctttggtagtcatagtagatgcagtgagctggcaagattatctgggaggcattatacagcatcactgctctagtggagaagcaaatcatgcagttctcataactgggtttgataaaacaggaagcactccatattggattgtgcggaattcctggggaagttcttggggagtagatggttatgcccatgtcaaaatgggaagtaatgtttgtggtattgcagattccgtttcttctatatttgtgtga
Sequence Length
966
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,958 Da
NCBI Official Full Name
Homo sapiens cathepsin O, mRNA
NCBI Official Synonym Full Names
cathepsin O
NCBI Official Symbol
CTSO
NCBI Official Synonym Symbols
CTSO1
NCBI Protein Information
cathepsin O
UniProt Protein Name
Cathepsin O
Protein Family
UniProt Gene Name
CTSO
UniProt Synonym Gene Names
CTSO1
UniProt Entry Name
CATO_HUMAN

NCBI Description

The protein encoded by the gene is a cysteine proteinase and a member of the papain superfamily. This proteolytic enzyme is involved in cellular protein degradation and turnover. The recombinant form of this enzyme was shown to degrade synthetic peptides typically used as substrates for cysteine proteinases and its proteolytic activity was abolished by an inhibitor of cyteine proteinase. [provided by RefSeq, Jul 2008]

Uniprot Description

CTSO: Proteolytic enzyme possibly involved in normal cellular protein degradation and turnover. Belongs to the peptidase C1 family.

Protein type: Cytoskeletal; EC 3.4.22.42; Protease

Chromosomal Location of Human Ortholog: 4q32.1

Cellular Component: extracellular space; lysosome

Molecular Function: cysteine-type endopeptidase activity

Biological Process: proteolysis; proteolysis involved in cellular protein catabolic process

Research Articles on CTSO

Similar Products

Product Notes

The CTSO ctso (Catalog #AAA1266179) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgtgc gggcgctgcc gtggctgccg tggctgctgt ggctgctgtg ccggggcggc ggcgatgcgg actcccgcgc ccccttcacc ccgacctggc cgcggagccg cgagcgtgaa gccgccgcct tccgggaaag tcttaataga catcgatact tgaattcttt atttcccagt gaaaactcca ccgccttcta tggaataaat cagttttcct atttgtttcc tgaagagttt aaagccattt atttaagaag caaaccttcc aagtttccca gatactcagc agaagtacat atgtccatcc ccaatgtgtc tttgccgtta agatttgact ggagggacaa gcaggttgtg acacaagtga gaaaccagca gatgtgtgga ggatgctggg ccttcagcgt ggtgggggca gtggaatctg cttatgcaat aaaggggaag cccctggaag acctaagtgt ccagcaggtc attgactgtt cgtataataa ttatggctgc aatggaggct ctactctcaa tgctttgaac tggttaaaca agatgcaagt aaaactggtg aaagattcag aatatccttt taaagcacaa aatggtctgt gccattactt ttctggttca cattctggat tttcaatcaa aggttattct gcatatgact tcagtgacca agaagatgaa atggcaaaag cacttcttac ctttggccct ttggtagtca tagtagatgc agtgagctgg caagattatc tgggaggcat tatacagcat cactgctcta gtggagaagc aaatcatgca gttctcataa ctgggtttga taaaacagga agcactccat attggattgt gcggaattcc tggggaagtt cttggggagt agatggttat gcccatgtca aaatgggaag taatgtttgt ggtattgcag attccgtttc ttctatattt gtgtga. It is sometimes possible for the material contained within the vial of "CTSO, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.