Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NHP2 cdna clone

NHP2 cDNA Clone

Gene Names
NHP2; DKCB2; NHP2P; NOLA2
Synonyms
NHP2; NHP2 cDNA Clone; NHP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccaaaataaaggcagatcccgacgggcccgaggctcaggcggaggcgtgttccggggagcgcacctaccaggagctgctggtcaaccagaaccccatcgcgcagcccctggcttctcgccgcctcacgcggaagctctacaaatgcatcaagaaagcggtgaagcagaagcagattcggcgcggggtgaaagaggttcagaaatttgtcaacaaaggagaaaaagggatcatggttttggcaggagacacactgcccattgaggtatactgccatctcccagtcatgtgtgaggaccgaaatttgccctatgtctatatcccctctaagacggacctgggtgcagccgcaggctccaagcgccccacctgtgtgataatggtcaagccccatgaggagtaccaggaggcttacgatgagtgcctggaggaggtgcagtccctgcccctacccctatga
Sequence Length
462
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,201 Da
NCBI Official Full Name
Homo sapiens NHP2 ribonucleoprotein homolog (yeast), mRNA
NCBI Official Synonym Full Names
NHP2 ribonucleoprotein
NCBI Official Symbol
NHP2
NCBI Official Synonym Symbols
DKCB2; NHP2P; NOLA2
NCBI Protein Information
H/ACA ribonucleoprotein complex subunit 2
UniProt Protein Name
H/ACA ribonucleoprotein complex subunit 2
Protein Family
UniProt Gene Name
NHP2
UniProt Synonym Gene Names
NOLA2
UniProt Entry Name
NHP2_HUMAN

NCBI Description

This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]

Uniprot Description

NOLA2: Required for ribosome biogenesis and telomere maintenance. Part of the H/ACA small nucleolar ribonucleoprotein (H/ACA snoRNP) complex, which catalyzes pseudouridylation of rRNA. This involves the isomerization of uridine such that the ribose is subsequently attached to C5, instead of the normal N1. Each rRNA can contain up to 100 pseudouridine (psi) residues, which may serve to stabilize the conformation of rRNAs. May also be required for correct processing or intranuclear trafficking of TERC, the RNA component of the telomerase reverse transcriptase (TERT) holoenzyme. Defects in NHP2 are the cause of dyskeratosis congenita autosomal recessive type 2 (DKCB2). A rare multisystem disorder caused by defective telomere maintenance. It is characterized by progressive bone marrow failure, and the clinical triad of reticulated skin hyperpigmentation, nail dystrophy, and mucosal leukoplakia. Common but variable features include premature graying, aplastic anemia, low platelets, osteoporosis, pulmonary fibrosis, and liver fibrosis among others. Early mortality is often associated with bone marrow failure, infections, fatal pulmonary complications, or malignancy. Belongs to the ribosomal protein L7Ae family.

Protein type: Nucleolus

Chromosomal Location of Human Ortholog: 5q35.3

Cellular Component: cytoplasm; nuclear chromosome, telomeric region; nucleoplasm; small nucleolar ribonucleoprotein complex; telomerase holoenzyme complex

Molecular Function: protein binding; snoRNA binding

Biological Process: cleavages during rRNA processing; maturation of LSU-rRNA; rRNA pseudouridine synthesis; snRNA pseudouridine synthesis; telomere maintenance via telomerase; translation

Disease: Dyskeratosis Congenita, Autosomal Recessive, 1; Dyskeratosis Congenita, Autosomal Recessive, 2

Research Articles on NHP2

Similar Products

Product Notes

The NHP2 nhp2 (Catalog #AAA1266157) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccaaaa taaaggcaga tcccgacggg cccgaggctc aggcggaggc gtgttccggg gagcgcacct accaggagct gctggtcaac cagaacccca tcgcgcagcc cctggcttct cgccgcctca cgcggaagct ctacaaatgc atcaagaaag cggtgaagca gaagcagatt cggcgcgggg tgaaagaggt tcagaaattt gtcaacaaag gagaaaaagg gatcatggtt ttggcaggag acacactgcc cattgaggta tactgccatc tcccagtcat gtgtgaggac cgaaatttgc cctatgtcta tatcccctct aagacggacc tgggtgcagc cgcaggctcc aagcgcccca cctgtgtgat aatggtcaag ccccatgagg agtaccagga ggcttacgat gagtgcctgg aggaggtgca gtccctgccc ctacccctat ga. It is sometimes possible for the material contained within the vial of "NHP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.