Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASAL1 cdna clone

RASAL1 cDNA Clone

Gene Names
RASAL1; RASAL
Synonyms
RASAL1; RASAL1 cDNA Clone; RASAL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaagagcagctccctgaatgttcgcgtggtggagggccgcgcgctgcctgccaaggacgtgtctgggagcagcgacccctactgcctagtgaaagtggacgacgaggtggtggccaggacagctactgtctggaggagcctgggccccttctggggggaggagtacacggtgcacctgcctctggatttccaccagctggccttctacgtgctggatgaggacactgtcgggcacgacgacatcatcggcaagatctcgctgagcagggaggcgattacagccgacccccgagggattgacagctggattaacttgagccgagtggacccagatgcagaagtgcagggtgagatctgcctgtcagtgcagatgctggaggatgggcagggccgctgccttcgctgccatgtgcttcaggccagggacctggctcccagagacatctctggcacatctgacccatttgcacgtgtgttttggggcagccagagcttggagacctcaaccatcaagaagactcgcttcccgcactgggatgaagtgctggagctgcgggagatgccaggtgccccgtccccactgcgggtggagctctgggactgggacatggtgggcaagaatgacttcttgggcatggtggagttctctccaaagaccctccagcagaagccacctaaaggctggttccgcctcctgccctttcccagagccgaggaggattctggggggaacctgggtgccctgcgagtgaaggtacgcctgattgaggaccgcgtcctgccctcccagtgctaccagcctctcatggagctgctcatggagtctgtgcaggggccagcagaggaggacactgctagccccttggctttgctggaagagctgaccttgggggactgccgccaggaccttgccaccaagctggtgaaactctttcttggccggggactggctgggcactttctggactatctcacccggcgtgaggtggctcggaccatggaccccaacaccctcttccgttctaactccctggcatccaagtcgatggaacagtttatgaagctcgtgggcatgccctacctgcacgaggtcctgaagcctgtgattagccgtgtctttgaggagaagaagtacatggagctggatccctgcaagatggacctgggccgcacccggaggatctccttcaaaggcgcactctcggaggagcagatgcgggagaccagcctggggctgctgacgggctacctggggcccatcgtggacgccatcgtgggctccgtggggcgctgcccgcccgccatgcgcctcgccttcaagcagctgcaccggcgagtggaggagcgcttcccccaggccgagcaccaggatgtgaagtacctggccatcagtggatttctcttcttgcgattcttcgcacctgccatccttaccccaaagctgtttgaccttcgggaccaacacgcggacccccagactagccgctcactgctgttgcttgccaaggctgtgcagagcattggaaacctgggccagcagctgggccaaggcaaggaactgtggatggcccccctgcaccccttcctgctgcagtgtgtctcacgtgtgagagacttcctggaccggctggtggatgtggatggggatgaagctggtgtcccagccagggccctgttcccgccctcggccattgttcgagaaggctatctgctgaagcgcaaggaggagcctgccggcctggccacgcgctttgccttcaagaagcgctacgtctggctcagcggggagaccctctccttctccaagagtcctgagtggcaggtggtgacgcaggacggcacgggggcgctgcacaccacctacctccagtgcaagaatgtgaatgagctcaaccagtggctctcggccttgcgcaaggccagcgcccccaacccgaacaagctggccgcctgccaccccggtgccttccgcagcgcgcgctggacctgctgcctccaggctgagcgctcagccgccggctgcagccgtacacactcagctgtcaccctgggggactggagtgacccactggatcctgatgctgaggcccagacagtgtatcggcagctgctcctggggcgggaccagctcaggctgaaattactggaggattctaacatggatacaactctggaggcagacacaggggcctgtcctgaggtcctggcccggcaaagagcagcaactgcccgcctgctggaggtgctcgcagacctggatcgtgcccacgaggagttccagcagcaggagcgagggaaggcggccctgggcccccttggcccctaa
Sequence Length
2331
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
90,145 Da
NCBI Official Full Name
Homo sapiens RAS protein activator like 1 (GAP1 like), mRNA
NCBI Official Synonym Full Names
RAS protein activator like 1
NCBI Official Symbol
RASAL1
NCBI Official Synonym Symbols
RASAL
NCBI Protein Information
rasGAP-activating-like protein 1
UniProt Protein Name
RasGAP-activating-like protein 1
UniProt Gene Name
RASAL1
UniProt Entry Name
RASL1_HUMAN

NCBI Description

The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. These proteins stimulate the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. This particular family member contains domains which are characteristic of the GAP1 subfamily of RasGAP proteins but, in contrast to the other GAP1 family members, this protein is strongly and selectively expressed in endocrine tissues. Alternatively spliced transcript variants that encode different isoforms have been described [provided by RefSeq, Jul 2010]

Uniprot Description

RASAL1: a GTPase activating protein for Ras. Negatively regulates Ras (H-Ras) signaling activity. Two alternatively-spliced isoforms have been described. PITX1 inhibits tumorigenicity of the Ras pathway by inducing the transcription of RASAL1, which in turn inactivates Ras. Two alternatively-spliced isoforms have been described.

Protein type: GAPs, Ras; GAPs

Chromosomal Location of Human Ortholog: 12q23-q24

Cellular Component: cytosol; plasma membrane

Molecular Function: phospholipid binding

Biological Process: MAPKKK cascade; negative regulation of Ras protein signal transduction; signal transduction

Research Articles on RASAL1

Similar Products

Product Notes

The RASAL1 rasal1 (Catalog #AAA1266107) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaaga gcagctccct gaatgttcgc gtggtggagg gccgcgcgct gcctgccaag gacgtgtctg ggagcagcga cccctactgc ctagtgaaag tggacgacga ggtggtggcc aggacagcta ctgtctggag gagcctgggc cccttctggg gggaggagta cacggtgcac ctgcctctgg atttccacca gctggccttc tacgtgctgg atgaggacac tgtcgggcac gacgacatca tcggcaagat ctcgctgagc agggaggcga ttacagccga cccccgaggg attgacagct ggattaactt gagccgagtg gacccagatg cagaagtgca gggtgagatc tgcctgtcag tgcagatgct ggaggatggg cagggccgct gccttcgctg ccatgtgctt caggccaggg acctggctcc cagagacatc tctggcacat ctgacccatt tgcacgtgtg ttttggggca gccagagctt ggagacctca accatcaaga agactcgctt cccgcactgg gatgaagtgc tggagctgcg ggagatgcca ggtgccccgt ccccactgcg ggtggagctc tgggactggg acatggtggg caagaatgac ttcttgggca tggtggagtt ctctccaaag accctccagc agaagccacc taaaggctgg ttccgcctcc tgccctttcc cagagccgag gaggattctg gggggaacct gggtgccctg cgagtgaagg tacgcctgat tgaggaccgc gtcctgccct cccagtgcta ccagcctctc atggagctgc tcatggagtc tgtgcagggg ccagcagagg aggacactgc tagccccttg gctttgctgg aagagctgac cttgggggac tgccgccagg accttgccac caagctggtg aaactctttc ttggccgggg actggctggg cactttctgg actatctcac ccggcgtgag gtggctcgga ccatggaccc caacaccctc ttccgttcta actccctggc atccaagtcg atggaacagt ttatgaagct cgtgggcatg ccctacctgc acgaggtcct gaagcctgtg attagccgtg tctttgagga gaagaagtac atggagctgg atccctgcaa gatggacctg ggccgcaccc ggaggatctc cttcaaaggc gcactctcgg aggagcagat gcgggagacc agcctggggc tgctgacggg ctacctgggg cccatcgtgg acgccatcgt gggctccgtg gggcgctgcc cgcccgccat gcgcctcgcc ttcaagcagc tgcaccggcg agtggaggag cgcttccccc aggccgagca ccaggatgtg aagtacctgg ccatcagtgg atttctcttc ttgcgattct tcgcacctgc catccttacc ccaaagctgt ttgaccttcg ggaccaacac gcggaccccc agactagccg ctcactgctg ttgcttgcca aggctgtgca gagcattgga aacctgggcc agcagctggg ccaaggcaag gaactgtgga tggcccccct gcaccccttc ctgctgcagt gtgtctcacg tgtgagagac ttcctggacc ggctggtgga tgtggatggg gatgaagctg gtgtcccagc cagggccctg ttcccgccct cggccattgt tcgagaaggc tatctgctga agcgcaagga ggagcctgcc ggcctggcca cgcgctttgc cttcaagaag cgctacgtct ggctcagcgg ggagaccctc tccttctcca agagtcctga gtggcaggtg gtgacgcagg acggcacggg ggcgctgcac accacctacc tccagtgcaa gaatgtgaat gagctcaacc agtggctctc ggccttgcgc aaggccagcg cccccaaccc gaacaagctg gccgcctgcc accccggtgc cttccgcagc gcgcgctgga cctgctgcct ccaggctgag cgctcagccg ccggctgcag ccgtacacac tcagctgtca ccctggggga ctggagtgac ccactggatc ctgatgctga ggcccagaca gtgtatcggc agctgctcct ggggcgggac cagctcaggc tgaaattact ggaggattct aacatggata caactctgga ggcagacaca ggggcctgtc ctgaggtcct ggcccggcaa agagcagcaa ctgcccgcct gctggaggtg ctcgcagacc tggatcgtgc ccacgaggag ttccagcagc aggagcgagg gaaggcggcc ctgggccccc ttggccccta a. It is sometimes possible for the material contained within the vial of "RASAL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.