Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

VGLL4 cdna clone

VGLL4 cDNA Clone

Gene Names
VGLL4; VGL-4
Synonyms
VGLL4; VGLL4 cDNA Clone; VGLL4 cdna clone
Ordering
For Research Use Only!
Sequence
atggagacgccattggatgttttgtccagggcagcatctctggtgcatgctgatgacgaaaaacgcgaagctgctctcaggggagaacccagaatgcagaccctgccggtggcctctgccctcagcagtcaccgcaccggccctcccccaatcagccccagcaagaggaagttcagcatggagccaggtgacgaggacctagactgtgacaacgaccacgtctccaaaatgagtcgcatcttcaacccccatctgaacaagactgccaatggagactgccgcagagacccccgggagcggagccgcagccccatcgagcgcgctgtggcccccaccatgagcctgcacggcagccacctgtacacctccctccccagccttggcctggagcagcccctcgcactgaccaagaacagcctggacgccagcaggccagccggcctctcgcccacactgaccccgggggagcggcagcagaaccggccctccgtgatcacctgtgcctcggctggcgcccgcaactgcaacctctcgcactgccccatcgcgcacagcggctgtgccgcgcccgggcctgccagctaccggaggccaccgagcgctgccaccacctgtgaccccgtggtggaggagcatttccgcaggagcctgggcaagaattacaaggagcccgagccggcacccaactccgtgtccatcacgggctccgtggacgaccactttgccaaagctctgggtgacacgtggctccagatcaaagcggccaaggacggagcatccagcagccctgagtccgcctctcgcaggggccagcccgccagcccctctgcccacatggtcagccacagtcactccccctctgtggtctcctga
Sequence Length
873
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,202 Da
NCBI Official Full Name
Homo sapiens vestigial like 4 (Drosophila), mRNA
NCBI Official Synonym Full Names
vestigial like family member 4
NCBI Official Symbol
VGLL4
NCBI Official Synonym Symbols
VGL-4
NCBI Protein Information
transcription cofactor vestigial-like protein 4
UniProt Protein Name
Transcription cofactor vestigial-like protein 4
UniProt Gene Name
VGLL4
UniProt Synonym Gene Names
KIAA0121; Vgl-4
UniProt Entry Name
VGLL4_HUMAN

Uniprot Description

VGLL4: May act as a specific coactivator for the mammalian TEFs. Belongs to the vestigial family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 3p25.3

Molecular Function: protein binding

Research Articles on VGLL4

Similar Products

Product Notes

The VGLL4 vgll4 (Catalog #AAA1266041) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacgc cattggatgt tttgtccagg gcagcatctc tggtgcatgc tgatgacgaa aaacgcgaag ctgctctcag gggagaaccc agaatgcaga ccctgccggt ggcctctgcc ctcagcagtc accgcaccgg ccctccccca atcagcccca gcaagaggaa gttcagcatg gagccaggtg acgaggacct agactgtgac aacgaccacg tctccaaaat gagtcgcatc ttcaaccccc atctgaacaa gactgccaat ggagactgcc gcagagaccc ccgggagcgg agccgcagcc ccatcgagcg cgctgtggcc cccaccatga gcctgcacgg cagccacctg tacacctccc tccccagcct tggcctggag cagcccctcg cactgaccaa gaacagcctg gacgccagca ggccagccgg cctctcgccc acactgaccc cgggggagcg gcagcagaac cggccctccg tgatcacctg tgcctcggct ggcgcccgca actgcaacct ctcgcactgc cccatcgcgc acagcggctg tgccgcgccc gggcctgcca gctaccggag gccaccgagc gctgccacca cctgtgaccc cgtggtggag gagcatttcc gcaggagcct gggcaagaat tacaaggagc ccgagccggc acccaactcc gtgtccatca cgggctccgt ggacgaccac tttgccaaag ctctgggtga cacgtggctc cagatcaaag cggccaagga cggagcatcc agcagccctg agtccgcctc tcgcaggggc cagcccgcca gcccctctgc ccacatggtc agccacagtc actccccctc tgtggtctcc tga. It is sometimes possible for the material contained within the vial of "VGLL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.