ABHD14A cdna clone
ABHD14A cDNA Clone
Gene Names
ABHD14A; DORZ1
Synonyms
ABHD14A; ABHD14A cDNA Clone; ABHD14A cdna clone
Sequence
atggtcggggcgctgtgcggctgctggttccgcctgggcggggcccgcccgctcatcccgttgggcccgactgtggtacagacctccatgagccagtcccaggtagccctgctgggcctgagtctgctgctcatgctcctactgtatgtggggctgccaggcccccctgagcagacttcctgcctctggggagaccccaatgtcacagtcctggctggtctcacccctggcaactcgcccatcttttaccgcgaggtgctcccactcaaccaggcacacagggtggaggtggtgctgcttcatggaaaggcctttaactctcacacgtgggagcagctgggcacactgcagctactgtcacagaggggctaccgggccgtggcccttgaccttccaggttttgggaactcggcaccttcaaaggaggcaagcacagaggcagggcgggcagcgctgctggagcgggcgctgcgggacctggaggtacagaatgccgtgttggtgagcccctcgctgagtggccactatgccctgcccttcctgatgcgaggccaccaccagctacatggatttgtgcccatcgcacccacctccacccagaactacacccaggagcaattctgggctgtgaagactccaacccttatcctgtatggagagctggaccacatcctggctcgagagtcactgcggcagctccgccacctgcccaaccactctgtggtgaagctacgcaatgcaggccatgcctgttacctccacaagccgcaagacttccaccttgtcctgcttgccttccttgaccatctaccttga
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,765 Da
NCBI Official Full Name
Homo sapiens abhydrolase domain containing 14A, mRNA
NCBI Official Synonym Full Names
abhydrolase domain containing 14A
NCBI Official Symbol
ABHD14A
NCBI Official Synonym Symbols
DORZ1
NCBI Protein Information
protein ABHD14A
UniProt Protein Name
Protein ABHD14A
Protein Family
UniProt Gene Name
ABHD14A
UniProt Synonym Gene Names
Abhydrolase domain-containing protein 14A
UniProt Entry Name
ABHEA_HUMAN
Uniprot Description
ABHD14A: Possible role in granule neuron development. Belongs to the AB hydrolase superfamily. ABHD14 family.
Protein type: EC 3.-.-.-; Membrane protein, integral; Hydrolase
Chromosomal Location of Human Ortholog: 3p21.1
Cellular Component: cytoplasm
Molecular Function: hydrolase activity
Research Articles on ABHD14A
Similar Products
Product Notes
The ABHD14A abhd14a (Catalog #AAA1266027) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcgggg cgctgtgcgg ctgctggttc cgcctgggcg gggcccgccc gctcatcccg ttgggcccga ctgtggtaca gacctccatg agccagtccc aggtagccct gctgggcctg agtctgctgc tcatgctcct actgtatgtg gggctgccag gcccccctga gcagacttcc tgcctctggg gagaccccaa tgtcacagtc ctggctggtc tcacccctgg caactcgccc atcttttacc gcgaggtgct cccactcaac caggcacaca gggtggaggt ggtgctgctt catggaaagg cctttaactc tcacacgtgg gagcagctgg gcacactgca gctactgtca cagaggggct accgggccgt ggcccttgac cttccaggtt ttgggaactc ggcaccttca aaggaggcaa gcacagaggc agggcgggca gcgctgctgg agcgggcgct gcgggacctg gaggtacaga atgccgtgtt ggtgagcccc tcgctgagtg gccactatgc cctgcccttc ctgatgcgag gccaccacca gctacatgga tttgtgccca tcgcacccac ctccacccag aactacaccc aggagcaatt ctgggctgtg aagactccaa cccttatcct gtatggagag ctggaccaca tcctggctcg agagtcactg cggcagctcc gccacctgcc caaccactct gtggtgaagc tacgcaatgc aggccatgcc tgttacctcc acaagccgca agacttccac cttgtcctgc ttgccttcct tgaccatcta ccttga. It is sometimes possible for the material contained within the vial of "ABHD14A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
