Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BAIAP2L1 cdna clone

BAIAP2L1 cDNA Clone

Gene Names
BAIAP2L1; IRTKS
Synonyms
BAIAP2L1; BAIAP2L1 cDNA Clone; BAIAP2L1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccgggggcccgaggaggtgaaccggctcacggagagcacctaccggaatgttatggaacagttcaatcctgggctgcgaaatttaataaacctggggaaaaattatgagaaagctgtaaacgctatgatcctggcaggaaaagcctactacgatggagtggccaagatcggtgagattgccactgggtcccccgtgtcaactgaactgggacatgtcctcatagagatttcaagtacccacaagaaactcaacgagagtcttgatgaaaattttaaaaaattccacaaagagattatccatgagctggagaagaagatagaacttgacgtgaaatatatgaacgcaactctaaaaagataccaaacagaacacaagaataaattagagtctttggagaaatcccaagctgagttgaagaagatcagaaggaaaagccaaggaagccgaaacgcactcaaatatgaacacaaagaaattgagtatgtggagaccgttacttctcgtcagagtgaaatccagaaattcattgcagatggttgcaaagaggctctgcttgaagagaagaggcgcttctgctttctggttgataagcactgtggctttgcaaaccacatacattattatcacttacagtctgcagaactactgaattccaagctgcctcggtggcaggagacctgtgttgatgccatcaaagtgccagagaaaatcatgaatatgatcgaagaaataaagaccccagcctctacccccgtgtctggaactcctcaggcttcacccatgatcgagagaagcaatgtggttaggaaagattacgacaccctttctaaatgctcaccaaagatgccccccgctccttcaggcagagcatataccagtcccttgatcgatatgtttaataacccagccacggctgccccgaattcacaaagggtaaataattcaacaggtacttccgaagatcccagtttacagcgatcagtttcggttgcaacgggactgaacatgatgaagaagcagaaagtgaagaccatcttcccgcacactgcgggctccaacaagaccttactcagctttgcacagggagatgtcatcacgctgctcatccccgaggagaaggatggctggctctatggagaacacgacgtgtccaaggcgaggggttggttcccgtcgtcgtacacgaagttgctggaagaaaatgagacagaagcagtgaccgtgcccacgccaagccccacaccagtgagaagcatcagcaccgtgaacttgtctgagaatagcagtgttgtcatccccccacccgactacttggaatgcttgtccatgggggcagctgccgacaggagagcagattcggccaggacgacatccacctttaaggccccagcgtccaagcccgagaccgcggctcctaacgatgccaacgggactgcaaagccgccttttctcagcggagaaaacccctttgccactgtgaaactccgcccgactgtgacgaatgatcgctcggcacccatcattcgatga
Sequence Length
1536
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,883 Da
NCBI Official Full Name
Homo sapiens BAI1-associated protein 2-like 1, mRNA
NCBI Official Synonym Full Names
BAI1 associated protein 2 like 1
NCBI Official Symbol
BAIAP2L1
NCBI Official Synonym Symbols
IRTKS
NCBI Protein Information
brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 1
UniProt Protein Name
Brain-specific angiogenesis inhibitor 1-associated protein 2-like protein 1
UniProt Gene Name
BAIAP2L1
UniProt Synonym Gene Names
IRTKS; BAI1-associated protein 2-like protein 1
UniProt Entry Name
BI2L1_HUMAN

NCBI Description

This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]

Uniprot Description

IRTKS: May function as adapter protein. Involved in the formation of clusters of actin bundles. Plays a role in the reorganization of the actin cytoskeleton in response to bacterial infection.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 7q22.1

Cellular Component: actin cytoskeleton; cell-cell adherens junction; cytoplasm; cytosol; nucleoplasm; plasma membrane

Molecular Function: cytoskeletal adaptor activity; protein binding

Biological Process: actin crosslink formation; actin filament bundle formation; insulin receptor signaling pathway; positive regulation of actin filament polymerization; response to bacterium

Research Articles on BAIAP2L1

Similar Products

Product Notes

The BAIAP2L1 baiap2l1 (Catalog #AAA1265860) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccggg ggcccgagga ggtgaaccgg ctcacggaga gcacctaccg gaatgttatg gaacagttca atcctgggct gcgaaattta ataaacctgg ggaaaaatta tgagaaagct gtaaacgcta tgatcctggc aggaaaagcc tactacgatg gagtggccaa gatcggtgag attgccactg ggtcccccgt gtcaactgaa ctgggacatg tcctcataga gatttcaagt acccacaaga aactcaacga gagtcttgat gaaaatttta aaaaattcca caaagagatt atccatgagc tggagaagaa gatagaactt gacgtgaaat atatgaacgc aactctaaaa agataccaaa cagaacacaa gaataaatta gagtctttgg agaaatccca agctgagttg aagaagatca gaaggaaaag ccaaggaagc cgaaacgcac tcaaatatga acacaaagaa attgagtatg tggagaccgt tacttctcgt cagagtgaaa tccagaaatt cattgcagat ggttgcaaag aggctctgct tgaagagaag aggcgcttct gctttctggt tgataagcac tgtggctttg caaaccacat acattattat cacttacagt ctgcagaact actgaattcc aagctgcctc ggtggcagga gacctgtgtt gatgccatca aagtgccaga gaaaatcatg aatatgatcg aagaaataaa gaccccagcc tctacccccg tgtctggaac tcctcaggct tcacccatga tcgagagaag caatgtggtt aggaaagatt acgacaccct ttctaaatgc tcaccaaaga tgccccccgc tccttcaggc agagcatata ccagtccctt gatcgatatg tttaataacc cagccacggc tgccccgaat tcacaaaggg taaataattc aacaggtact tccgaagatc ccagtttaca gcgatcagtt tcggttgcaa cgggactgaa catgatgaag aagcagaaag tgaagaccat cttcccgcac actgcgggct ccaacaagac cttactcagc tttgcacagg gagatgtcat cacgctgctc atccccgagg agaaggatgg ctggctctat ggagaacacg acgtgtccaa ggcgaggggt tggttcccgt cgtcgtacac gaagttgctg gaagaaaatg agacagaagc agtgaccgtg cccacgccaa gccccacacc agtgagaagc atcagcaccg tgaacttgtc tgagaatagc agtgttgtca tccccccacc cgactacttg gaatgcttgt ccatgggggc agctgccgac aggagagcag attcggccag gacgacatcc acctttaagg ccccagcgtc caagcccgag accgcggctc ctaacgatgc caacgggact gcaaagccgc cttttctcag cggagaaaac ccctttgcca ctgtgaaact ccgcccgact gtgacgaatg atcgctcggc acccatcatt cgatga. It is sometimes possible for the material contained within the vial of "BAIAP2L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.