Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SOX15 cdna clone

SOX15 cDNA Clone

Synonyms
SOX15; SOX15 cDNA Clone; SOX15 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctaccaggctcctcacaggaccaggcctggagcctggagcctccggctgccacggctgctgcctcctcatcttcgggaccccaggagcgggagggcgctgggagccccgcggcccccgggacgctgcccctggagaaggtgaagcggccgatgaacgcgttcatggtgtggagctccgctcagcgccgccagatggcgcagcagaaccccaagatgcacaactccgagatctccaagcgcctgggcgcgcagtggaagctgctggacgaggacgagaagcggcccttcgtggaggaggccaagcggctccgcgcccgacacctgcgcgactaccccgactacaagtaccggcctcggcgcaaggccaagagctcgggcgccggaccttcccgctgcggacagggaagaggcaacctggccagcggcggcccgctctgggggccggggtacgcgaccacccaaccgagcagaggctttgggtacagaccccccagctactcgacagcctacctgcctggcagctatggctcttcccactgcaaactggaagccccctcaccgtgctccctccctcagagtgaccctaggctccagggggaactgctgcccacctatacccactacctgccccctggctctcccactccatacaaccctccccttgctggtgcccccatgcccctaacccacctctaa
Sequence Length
702
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,393 Da
NCBI Official Full Name
Homo sapiens SRY (sex determining region Y)-box 15, mRNA
UniProt Protein Name
Protein SOX-15
Protein Family
UniProt Gene Name
SOX15
UniProt Synonym Gene Names
SOX12; SOX20; SOX26; SOX27
UniProt Entry Name
SOX15_HUMAN

Uniprot Description

SOX15: Binds to the 5'-AACAAT-3' sequence.

Protein type: Transcription factor; DNA-binding; Cell development/differentiation

Chromosomal Location of Human Ortholog: 17p13.1

Molecular Function: protein binding

Biological Process: cell differentiation; male gonad development; myoblast development; negative regulation of striated muscle development; negative regulation of transcription from RNA polymerase II promoter; positive regulation of satellite cell activation involved in skeletal muscle regeneration; positive regulation of transcription from RNA polymerase II promoter; regulation of transcription from RNA polymerase II promoter

Similar Products

Product Notes

The SOX15 sox15 (Catalog #AAA1265830) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctac caggctcctc acaggaccag gcctggagcc tggagcctcc ggctgccacg gctgctgcct cctcatcttc gggaccccag gagcgggagg gcgctgggag ccccgcggcc cccgggacgc tgcccctgga gaaggtgaag cggccgatga acgcgttcat ggtgtggagc tccgctcagc gccgccagat ggcgcagcag aaccccaaga tgcacaactc cgagatctcc aagcgcctgg gcgcgcagtg gaagctgctg gacgaggacg agaagcggcc cttcgtggag gaggccaagc ggctccgcgc ccgacacctg cgcgactacc ccgactacaa gtaccggcct cggcgcaagg ccaagagctc gggcgccgga ccttcccgct gcggacaggg aagaggcaac ctggccagcg gcggcccgct ctgggggccg gggtacgcga ccacccaacc gagcagaggc tttgggtaca gaccccccag ctactcgaca gcctacctgc ctggcagcta tggctcttcc cactgcaaac tggaagcccc ctcaccgtgc tccctccctc agagtgaccc taggctccag ggggaactgc tgcccaccta tacccactac ctgccccctg gctctcccac tccatacaac cctccccttg ctggtgcccc catgccccta acccacctct aa. It is sometimes possible for the material contained within the vial of "SOX15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.