Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TYRO3 cdna clone

TYRO3 cDNA Clone

Gene Names
TYRO3; BYK; Dtk; RSE; Rek; Sky; Tif; Etk-2
Synonyms
TYRO3; TYRO3 cDNA Clone; TYRO3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgaggcggagcatggggcggccggggctcccgccgctgccgctgccgccgccaccgcggctcgggctgctgctggcggctctggcttctctgctgctcccggagtccgccgccgcaggtctgaagctcatgggagccccggtgaagctgacagtgtctcaggggcagccggtgaagctcaactgcagtgtggaggggatggaggagcctgacatccagtgggtgaaggatggggctgtggtccagaacttggaccagttgtacatcccagtcagcgagcagcactggatcggcttcctcagcctgaagtcagtggagcgctctgacgccggccggtactggtgccaggtggaggatgggggtgaaaccgagatctcccagccagtgtggctcacggtagaaggtgtgccatttttcacagtggagccaaaagatctggcagtgccacccaatgcccctttccaactgtcttgtgaggctgtgggtccccctgaacctgttaccattgtctggtggagaggaactacgaagatcgggggacccgctccctctccatctgttttaaatgtaacaggggtgacccagagcaccatgttttcctgtgaagctcacaacctaaaaggcctggcctcttctcgcacagccactgttcaccttcaagcactgcctgcagcccccttcaacatcaccgtgacaaagctttccagcagcaacgctagtgtggcctggatgccaggtgccgatggccgagctctgctacagtcctgtacagttcaggtgacacaggccccaggaggctgggaagtcctggctgttgtggtccctgtgcccccctttacctgcctgctccgggacctggtgcctgccaccaactacagcctcagggtgcgctgtgccaatgccttggggccctctccctatgctgactgggtgccctttcagaccaagggtctagccccagccagcgctccccaaaacctccatgccatccgcacagattcaggcctcatcttggagtgggaagaagtgatccccgaggcccctttggaaggccccctgggaccctacaaactgtcctgggttcaagacaatggaacccaggatgagctgacagtggaggggaccagggccaatttgacaggctgggatccccaaaaggacctgatcgtacgtgtgtgcgtctccaatgcagttggctgtggaccctggagtcagccactggtggtctcttctcatgaccgtgcaggccagcagggccctcctcacagccgcacatcctgggtacctgtggtccttggtgtgctaacggccctggtgacggctgctgccctggccctcatcctgcttcgaaagagacggaaagagacgcggtttgggcaagcctttgacagtgtcatggcccggggagagccagccgttcacttccgggcagcccggtccttcaatcgagaaaggcccgagcgcatcgaggccacattggacagcttgggcatcagcgatgaactaaaggaaaaactggaggatgtgctcatcccagagcagcagttcaccctgggccggatgttgggcaaaggagagtttggttcagtgcgggaggcccagctgaagcaagaggatggctcctttgtgaaagtggctgtgaagatgctgaaagctgacatcattgcctcaagcgacattgaagagttcctcagggaagcagcttgcatgaaggagtttgaccatccacacgtggccaaacttgttggggtaagcctccggagcagggctaaaggccgtctccccatccccatggtcatcttgcccttcatgaagcatggggacctgcatgccttcctgctcgcctcccggattggggagaacccctttaacctacccctccagaccctgatccggttcatggtggacattgcctgcggcatggagtacctgagctctcggaacttcatccaccgagacctggctgctcggaattgcatgctggcagaggacatgacagtgtgtgtggctgacttcggactctcccggaagatctacagtggggactactatcgtcaaggctgtgcctccaaactgcctgtcaagtggctggccctggagagcctggccgacaacctgtatactgtgcagagtgacgtgtgggcgttcggggtgaccatgtgggagatcatgacacgtgggcagacgccatatgctggcatcgaaaacgctgagatttacaactacctcattggcgggaaccgcctgaaacagcctccggagtgtatggaggacgtgtatgatctcatgtaccagtgctggagtgctgaccccaagcagcgcccgagctttacttgtctgcgaatggaactggagaacatcttgggccagctgtctgtgctatctgccagccaggaccccttatacatcaacatcgagagagctgaggagcccactgcgggaggcagcctggagctacctggcagggatcagccctacagtggggctggggatggcagtggcatgggggcagtgggtggcactcccagtgactgtcggtacatactcacccccggagggctggctgagcagccagggcaggcagagcaccagccagagagtcccctcaatgagacacagaggcttttgctgctgcagcaagggctactgccacacagtagctgttag
Sequence Length
2673
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
96,905 Da
NCBI Official Full Name
Homo sapiens TYRO3 protein tyrosine kinase, mRNA
NCBI Official Synonym Full Names
TYRO3 protein tyrosine kinase
NCBI Official Symbol
TYRO3
NCBI Official Synonym Symbols
BYK; Dtk; RSE; Rek; Sky; Tif; Etk-2
NCBI Protein Information
tyrosine-protein kinase receptor TYRO3
UniProt Protein Name
Tyrosine-protein kinase receptor TYRO3
UniProt Gene Name
TYRO3
UniProt Synonym Gene Names
BYK; DTK; RSE; SKY; TIF
UniProt Entry Name
TYRO3_HUMAN

NCBI Description

The gene is part of a 3-member transmembrane receptor kinase receptor family with a processed pseudogene distal on chromosome 15. The encoded protein is activated by the products of the growth arrest-specific gene 6 and protein S genes and is involved in controlling cell survival and proliferation, spermatogenesis, immunoregulation and phagocytosis. The encoded protein has also been identified as a cell entry factor for Ebola and Marburg viruses. [provided by RefSeq, May 2010]

Uniprot Description

Tyro3: Receptor tyrosine kinase that transduces signals from the extracellular matrix into the cytoplasm by binding to several ligands including TUB, TULP1 or GAS6. Regulates many physiological processes including cell survival, migration and differentiation. Ligand binding at the cell surface induces dimerization and autophosphorylation of TYRO3 on its intracellular domain that provides docking sites for downstream signaling molecules. Following activation by ligand, interacts with PIK3R1 and thereby enhances PI3-kinase activity. Activates the AKT survival pathway, including nuclear translocation of NF-kappa-B and up-regulation of transcription of NF-kappa-B-regulated genes. TYRO3 signaling plays a role in various processes such as neuron protection from excitotoxic injury, platelet aggregation and cytoskeleton reorganization. Plays also an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response by activating STAT1, which selectively induces production of suppressors of cytokine signaling SOCS1 and SOCS3. Monomer and homodimer. Interacts (via N-terminus) with extracellular ligands TUB, TULP1 and GAS6. Interacts with PIK3R1; this interaction increases PI3-kinase activity. Abundant in the brain and lower levels in other tissues. Belongs to the protein kinase superfamily. Tyr protein kinase family. AXL/UFO subfamily.

Protein type: EC 2.7.10.1; Protein kinase, TK; Protein kinase, tyrosine (receptor); Membrane protein, integral; Kinase, protein; TK group; Axl family

Chromosomal Location of Human Ortholog: 15q15

Cellular Component: endoplasmic reticulum membrane; nuclear envelope; nucleus

Molecular Function: phosphoinositide 3-kinase binding; protein binding; protein-tyrosine kinase activity

Biological Process: apoptotic cell clearance; forebrain cell migration; negative regulation of inflammatory response; negative regulation of innate immune response; negative regulation of neuron apoptosis; negative regulation of toll-like receptor signaling pathway; ovulation cycle; platelet activation; protein amino acid autophosphorylation; protein kinase B signaling cascade; secretion by cell; spermatogenesis

Research Articles on TYRO3

Similar Products

Product Notes

The TYRO3 tyro3 (Catalog #AAA1265827) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctga ggcggagcat ggggcggccg gggctcccgc cgctgccgct gccgccgcca ccgcggctcg ggctgctgct ggcggctctg gcttctctgc tgctcccgga gtccgccgcc gcaggtctga agctcatggg agccccggtg aagctgacag tgtctcaggg gcagccggtg aagctcaact gcagtgtgga ggggatggag gagcctgaca tccagtgggt gaaggatggg gctgtggtcc agaacttgga ccagttgtac atcccagtca gcgagcagca ctggatcggc ttcctcagcc tgaagtcagt ggagcgctct gacgccggcc ggtactggtg ccaggtggag gatgggggtg aaaccgagat ctcccagcca gtgtggctca cggtagaagg tgtgccattt ttcacagtgg agccaaaaga tctggcagtg ccacccaatg cccctttcca actgtcttgt gaggctgtgg gtccccctga acctgttacc attgtctggt ggagaggaac tacgaagatc gggggacccg ctccctctcc atctgtttta aatgtaacag gggtgaccca gagcaccatg ttttcctgtg aagctcacaa cctaaaaggc ctggcctctt ctcgcacagc cactgttcac cttcaagcac tgcctgcagc ccccttcaac atcaccgtga caaagctttc cagcagcaac gctagtgtgg cctggatgcc aggtgccgat ggccgagctc tgctacagtc ctgtacagtt caggtgacac aggccccagg aggctgggaa gtcctggctg ttgtggtccc tgtgcccccc tttacctgcc tgctccggga cctggtgcct gccaccaact acagcctcag ggtgcgctgt gccaatgcct tggggccctc tccctatgct gactgggtgc cctttcagac caagggtcta gccccagcca gcgctcccca aaacctccat gccatccgca cagattcagg cctcatcttg gagtgggaag aagtgatccc cgaggcccct ttggaaggcc ccctgggacc ctacaaactg tcctgggttc aagacaatgg aacccaggat gagctgacag tggaggggac cagggccaat ttgacaggct gggatcccca aaaggacctg atcgtacgtg tgtgcgtctc caatgcagtt ggctgtggac cctggagtca gccactggtg gtctcttctc atgaccgtgc aggccagcag ggccctcctc acagccgcac atcctgggta cctgtggtcc ttggtgtgct aacggccctg gtgacggctg ctgccctggc cctcatcctg cttcgaaaga gacggaaaga gacgcggttt gggcaagcct ttgacagtgt catggcccgg ggagagccag ccgttcactt ccgggcagcc cggtccttca atcgagaaag gcccgagcgc atcgaggcca cattggacag cttgggcatc agcgatgaac taaaggaaaa actggaggat gtgctcatcc cagagcagca gttcaccctg ggccggatgt tgggcaaagg agagtttggt tcagtgcggg aggcccagct gaagcaagag gatggctcct ttgtgaaagt ggctgtgaag atgctgaaag ctgacatcat tgcctcaagc gacattgaag agttcctcag ggaagcagct tgcatgaagg agtttgacca tccacacgtg gccaaacttg ttggggtaag cctccggagc agggctaaag gccgtctccc catccccatg gtcatcttgc ccttcatgaa gcatggggac ctgcatgcct tcctgctcgc ctcccggatt ggggagaacc cctttaacct acccctccag accctgatcc ggttcatggt ggacattgcc tgcggcatgg agtacctgag ctctcggaac ttcatccacc gagacctggc tgctcggaat tgcatgctgg cagaggacat gacagtgtgt gtggctgact tcggactctc ccggaagatc tacagtgggg actactatcg tcaaggctgt gcctccaaac tgcctgtcaa gtggctggcc ctggagagcc tggccgacaa cctgtatact gtgcagagtg acgtgtgggc gttcggggtg accatgtggg agatcatgac acgtgggcag acgccatatg ctggcatcga aaacgctgag atttacaact acctcattgg cgggaaccgc ctgaaacagc ctccggagtg tatggaggac gtgtatgatc tcatgtacca gtgctggagt gctgacccca agcagcgccc gagctttact tgtctgcgaa tggaactgga gaacatcttg ggccagctgt ctgtgctatc tgccagccag gaccccttat acatcaacat cgagagagct gaggagccca ctgcgggagg cagcctggag ctacctggca gggatcagcc ctacagtggg gctggggatg gcagtggcat gggggcagtg ggtggcactc ccagtgactg tcggtacata ctcacccccg gagggctggc tgagcagcca gggcaggcag agcaccagcc agagagtccc ctcaatgaga cacagaggct tttgctgctg cagcaagggc tactgccaca cagtagctgt tag. It is sometimes possible for the material contained within the vial of "TYRO3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.