FBXO30 cdna clone
FBXO30 cDNA Clone
Gene Names
FBXO30; Fbx30
Synonyms
FBXO30; FBXO30 cDNA Clone; FBXO30 cdna clone
Sequence
atggcccgaaataaagttgctgaacatctagaaatgtgtcctgcaagtgtggtgtgctgtactatggaatggaatcgatggccagttagttatgcagaccggaaatcatatgaaaatctaagcagagatgtcgatgaagtggcacaattggatatggccttggctcttcaagaccaaaggatgctcttagaatccctcaaagtagccaccatgatgtcaaaagcaactgataaagtatccaaacctagagaacaaatctcagttaaatcaagtgtcccagaaataccacatgctaatggtttagtgtctgttgatgaagaatcttatggtgcactttatcaagctactgtagaaacaaccagaagtttggctgctgctttggatatcctgaatactgctacaagagacattggcatgttaaatacaagtgtcccaaatgacatggatgaacagcaaaatgcgagagaaagcttagaggatcaaaacttgaaagaccaagatcatctttatgaggaggaaataggagcagtaggtggaattgactacaatgacacaaatcagaatgcccagtctgaacaaaatggttcaagtgatttattatgtgacttgaatacaagttcttatgacacttctgctctttgtaatggctttcctttggaaaatatatgtacccaggtcatagaccagaatcagaatttacatggtgattcaaaacaaagtaacttaacaaatggagactgtgtggcatcatcagatggcacttcaaaaccttccagctcacttgcggtggcagcacaacttagggaaataataccatccagtgctttgcctaatggcacagttcagcatatcctcatgccagatgatgaaggtgaaggtgaattgtgttggaaaaaagtagacttaggggacgtgaagaatgtggatgtcttatctttcagtcatgctccttcattcaattttctttctaattcatgttggtctaaaccaaaggaagataaagcagtagatacatcagatttggaagttgcagaagatcctatgggcctccaaggaatagatctgatcacagcagcattgcttttttgtctaggagattctccaggagggaggggtatatctgatagccgcatggctgatatttatcacattgacgttgggactcagactttttcacttccatctgcaatattagctacaagtacaatggttggggagatagcttcagcttcagcttgtgatcatgccaatccacagctttcaaatccaagtccgtttcagacacttgggctggatttagtattggaatgtgtcgctaggtaccaacccaagcagcgttcaatgtttacctttgtgtgtggacagttatttagaaggaaagaattttcttcccactttaagaatgtgcatggtgacattcatgctggactcaatggctggatggaacagaggtgccctttagcttactatggttgtacctattctcagcgtagattttgtccatcaatacaaggagcaaagattatacatgaccgccatttgaggtcatttggagttcagccatgtgtatctacagtattagtggagcctgctagaaactgtgtgttgggattacataatgaccatctaagtagtcttccttttgaggtcctgcagcatattgcaggctttctcgatggcttcagcttatgtcagctctcatgtgtatccaagttaatgagggatgtgtgtggcagcctgcttcagtctcgtggcatggtcatactgcagtgggggaaaaggaagtatccagaaggaaattcatcatggcagataaaagaaaaggtatggcgatttagtactgcattttgttctgttaatgaatggaaatttgctgacatcctaagcatggcagaccacttgaagaaatgcagttacaatgttgtcgagaaacgggaggaagcaatccctttgccatgtatgtgtgtgacacgagaactcactaaagaaggacgttcactacgctcagttttaaaacctgtactttaa
Sequence Length
2028
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
82,304 Da
NCBI Official Full Name
Homo sapiens F-box protein 30, mRNA
NCBI Official Synonym Full Names
F-box protein 30
NCBI Official Symbol
FBXO30
NCBI Official Synonym Symbols
Fbx30
NCBI Protein Information
F-box only protein 30
UniProt Protein Name
F-box only protein 30
Protein Family
UniProt Gene Name
FBXO30
UniProt Synonym Gene Names
FBX30
UniProt Entry Name
FBX30_HUMAN
NCBI Description
This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it is upregulated in nasopharyngeal carcinoma. [provided by RefSeq, Jul 2008]
Uniprot Description
FBXO30: Substrate-recognition component of the SCF (SKP1-CUL1-F- box protein)-type E3 ubiquitin ligase complex.
Protein type: Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 6q24
Research Articles on FBXO30
Similar Products
Product Notes
The FBXO30 fbxo30 (Catalog #AAA1265787) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccgaa ataaagttgc tgaacatcta gaaatgtgtc ctgcaagtgt ggtgtgctgt actatggaat ggaatcgatg gccagttagt tatgcagacc ggaaatcata tgaaaatcta agcagagatg tcgatgaagt ggcacaattg gatatggcct tggctcttca agaccaaagg atgctcttag aatccctcaa agtagccacc atgatgtcaa aagcaactga taaagtatcc aaacctagag aacaaatctc agttaaatca agtgtcccag aaataccaca tgctaatggt ttagtgtctg ttgatgaaga atcttatggt gcactttatc aagctactgt agaaacaacc agaagtttgg ctgctgcttt ggatatcctg aatactgcta caagagacat tggcatgtta aatacaagtg tcccaaatga catggatgaa cagcaaaatg cgagagaaag cttagaggat caaaacttga aagaccaaga tcatctttat gaggaggaaa taggagcagt aggtggaatt gactacaatg acacaaatca gaatgcccag tctgaacaaa atggttcaag tgatttatta tgtgacttga atacaagttc ttatgacact tctgctcttt gtaatggctt tcctttggaa aatatatgta cccaggtcat agaccagaat cagaatttac atggtgattc aaaacaaagt aacttaacaa atggagactg tgtggcatca tcagatggca cttcaaaacc ttccagctca cttgcggtgg cagcacaact tagggaaata ataccatcca gtgctttgcc taatggcaca gttcagcata tcctcatgcc agatgatgaa ggtgaaggtg aattgtgttg gaaaaaagta gacttagggg acgtgaagaa tgtggatgtc ttatctttca gtcatgctcc ttcattcaat tttctttcta attcatgttg gtctaaacca aaggaagata aagcagtaga tacatcagat ttggaagttg cagaagatcc tatgggcctc caaggaatag atctgatcac agcagcattg cttttttgtc taggagattc tccaggaggg aggggtatat ctgatagccg catggctgat atttatcaca ttgacgttgg gactcagact ttttcacttc catctgcaat attagctaca agtacaatgg ttggggagat agcttcagct tcagcttgtg atcatgccaa tccacagctt tcaaatccaa gtccgtttca gacacttggg ctggatttag tattggaatg tgtcgctagg taccaaccca agcagcgttc aatgtttacc tttgtgtgtg gacagttatt tagaaggaaa gaattttctt cccactttaa gaatgtgcat ggtgacattc atgctggact caatggctgg atggaacaga ggtgcccttt agcttactat ggttgtacct attctcagcg tagattttgt ccatcaatac aaggagcaaa gattatacat gaccgccatt tgaggtcatt tggagttcag ccatgtgtat ctacagtatt agtggagcct gctagaaact gtgtgttggg attacataat gaccatctaa gtagtcttcc ttttgaggtc ctgcagcata ttgcaggctt tctcgatggc ttcagcttat gtcagctctc atgtgtatcc aagttaatga gggatgtgtg tggcagcctg cttcagtctc gtggcatggt catactgcag tgggggaaaa ggaagtatcc agaaggaaat tcatcatggc agataaaaga aaaggtatgg cgatttagta ctgcattttg ttctgttaat gaatggaaat ttgctgacat cctaagcatg gcagaccact tgaagaaatg cagttacaat gttgtcgaga aacgggagga agcaatccct ttgccatgta tgtgtgtgac acgagaactc actaaagaag gacgttcact acgctcagtt ttaaaacctg tactttaa. It is sometimes possible for the material contained within the vial of "FBXO30, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
