Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TOMM22 cdna clone

TOMM22 cDNA Clone

Gene Names
TOMM22; 1C9-2; TOM22; MST065; MSTP065
Synonyms
TOMM22; TOMM22 cDNA Clone; TOMM22 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgccgccgtcgctgctgccggtgcaggggaaccccagtccccggacgaattgctcccgaaaggcgacgcggagaagcctgaggaggagctggaggaggacgacgatgaggagctagatgagaccctgtcggagagactatggggcctgacggagatgtttccggagagggtccggtccgcggccggagccacttttgatctttccctctttgtggctcagaaaatgtacaggttttccagggcagccttgtggattgggaccacttcctttatgatcctggttcttcccgttgtctttgagacggagaagttgcaaatggagcaacagcagcaactgcagcagcggcagatacttctaggacctaacacagggctctcaggaggaatgccaggggctctaccctcacttcctggaaagatctag
Sequence Length
429
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,522 Da
NCBI Official Full Name
Homo sapiens translocase of outer mitochondrial membrane 22 homolog (yeast), mRNA
NCBI Official Synonym Full Names
translocase of outer mitochondrial membrane 22
NCBI Official Symbol
TOMM22
NCBI Official Synonym Symbols
1C9-2; TOM22; MST065; MSTP065
NCBI Protein Information
mitochondrial import receptor subunit TOM22 homolog
UniProt Protein Name
Mitochondrial import receptor subunit TOM22 homolog
UniProt Gene Name
TOMM22
UniProt Synonym Gene Names
TOM22; hTom22
UniProt Entry Name
TOM22_HUMAN

NCBI Description

The protein encoded by this gene is an integral membrane protein of the mitochondrial outer membrane. The encoded protein interacts with TOMM20 and TOMM40, and forms a complex with several other proteins to import cytosolic preproteins into the mitochondrion. [provided by RefSeq, Jul 2008]

Uniprot Description

TOMM22: Central receptor component of the translocase of the outer membrane of mitochondria (TOM complex) responsible for the recognition and translocation of cytosolically synthesized mitochondrial preproteins. Together with the peripheral receptor TOM20 functions as the transit peptide receptor and facilitates the movement of preproteins into the translocation pore. Belongs to the Tom22 family.

Protein type: Membrane protein, integral; Mitochondrial

Chromosomal Location of Human Ortholog: 22q13.1

Cellular Component: integral to membrane; integral to mitochondrial outer membrane; membrane; mitochondrial outer membrane; mitochondrial outer membrane translocase complex; mitochondrion

Molecular Function: protein binding; protein channel activity; protein transmembrane transporter activity

Biological Process: macroautophagy; protein import into mitochondrial matrix; protein import into mitochondrial outer membrane; protein targeting to mitochondrion

Research Articles on TOMM22

Similar Products

Product Notes

The TOMM22 tomm22 (Catalog #AAA1265759) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgccg ccgtcgctgc tgccggtgca ggggaacccc agtccccgga cgaattgctc ccgaaaggcg acgcggagaa gcctgaggag gagctggagg aggacgacga tgaggagcta gatgagaccc tgtcggagag actatggggc ctgacggaga tgtttccgga gagggtccgg tccgcggccg gagccacttt tgatctttcc ctctttgtgg ctcagaaaat gtacaggttt tccagggcag ccttgtggat tgggaccact tcctttatga tcctggttct tcccgttgtc tttgagacgg agaagttgca aatggagcaa cagcagcaac tgcagcagcg gcagatactt ctaggaccta acacagggct ctcaggagga atgccagggg ctctaccctc acttcctgga aagatctag. It is sometimes possible for the material contained within the vial of "TOMM22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.