Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MTX1 cdna clone

MTX1 cDNA Clone

Gene Names
MTX1; MTX; MTXN
Synonyms
MTX1; MTX1 cDNA Clone; MTX1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgcccatggagctgttctgctggtcagggggctgggggctgccgtcagtggacctggacagcctggccgtgctgacctatgccagatttactggtgctccactgaaggtacacaagatcagcaacccctggcagagcccttcaggaactctgcctgcccttcggaccagtcatggagaggtcatctcagttccacacaagatcatcacccaccttcgaaaagaggtacatactttttggatagacaccaagaactacgtggaagtgacccggaagtggtatgcagaggctatgccctttcccctcaacttcttcctgcctggccgcatgcagcggcagtacatggaacggctacagctgctgactggggagcacaggcctgaggacgaggaagagctggagaaggagctgtaccgagaggctcgggagtgtctgaccctgctctctcagcgcctgggctctcaaaagttcttctttggagatgcccctgcctccttggacgccttcgtcttcagctacttggccctgctgctgcaggcaaagctgcccagtgggaagctgcaggtccacctgcgtgggctgcacaacctctgtgcctattgtacccacattctcagtctctacttcccctgggatggagctgaggtaccaccgcaacgccagacaccagcaggcccagagactgaggaggagccataccggcgccggaaccagatcctatctgtgctggcaggactggcagccatggtgggctacgccttgctcagcggcattgtctccatccagcgggcaacgcctgctcgggccccaggcacccggaccctgggcatggctgaggaggatgaagaggaatga
Sequence Length
861
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,777 Da
NCBI Official Full Name
Homo sapiens metaxin 1, mRNA
NCBI Official Synonym Full Names
metaxin 1
NCBI Official Symbol
MTX1
NCBI Official Synonym Symbols
MTX; MTXN
NCBI Protein Information
metaxin-1
UniProt Protein Name
Metaxin-1
Protein Family
UniProt Gene Name
MTX1
UniProt Synonym Gene Names
MTX; MTXN
UniProt Entry Name
MTX1_HUMAN

Uniprot Description

MTX1: Involved in transport of proteins into the mitochondrion. Essential for embryonic development. Belongs to the metaxin family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Mitochondrial

Chromosomal Location of Human Ortholog: 1q21

Research Articles on MTX1

Similar Products

Product Notes

The MTX1 mtx1 (Catalog #AAA1265714) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc ccatggagct gttctgctgg tcagggggct gggggctgcc gtcagtggac ctggacagcc tggccgtgct gacctatgcc agatttactg gtgctccact gaaggtacac aagatcagca acccctggca gagcccttca ggaactctgc ctgcccttcg gaccagtcat ggagaggtca tctcagttcc acacaagatc atcacccacc ttcgaaaaga ggtacatact ttttggatag acaccaagaa ctacgtggaa gtgacccgga agtggtatgc agaggctatg ccctttcccc tcaacttctt cctgcctggc cgcatgcagc ggcagtacat ggaacggcta cagctgctga ctggggagca caggcctgag gacgaggaag agctggagaa ggagctgtac cgagaggctc gggagtgtct gaccctgctc tctcagcgcc tgggctctca aaagttcttc tttggagatg cccctgcctc cttggacgcc ttcgtcttca gctacttggc cctgctgctg caggcaaagc tgcccagtgg gaagctgcag gtccacctgc gtgggctgca caacctctgt gcctattgta cccacattct cagtctctac ttcccctggg atggagctga ggtaccaccg caacgccaga caccagcagg cccagagact gaggaggagc cataccggcg ccggaaccag atcctatctg tgctggcagg actggcagcc atggtgggct acgccttgct cagcggcatt gtctccatcc agcgggcaac gcctgctcgg gccccaggca cccggaccct gggcatggct gaggaggatg aagaggaatg a. It is sometimes possible for the material contained within the vial of "MTX1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.