Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SSH2 cdna clone

SSH2 cDNA Clone

Gene Names
SSH2; SSH-2; SSH-2L
Synonyms
SSH2; SSH2 cDNA Clone; SSH2 cdna clone
Ordering
For Research Use Only!
Sequence
atgattccttacttctccgccaacgcggtcatctcgcagaacgccatcaaccagctcatcagcgagagctttctaactgtcaaaggtgctgccctttttctaccacggggaaatggctcatccacaccaagaatcagccacagacggaacaagcatgcaggcgatctccaacagcatctccaagcaatgttcattttactccgcccagaagacaacatcaggctggctgtaagactggaaagtacttaccagaatcgaacacgctatatggtagtggtttcaactaatggtagacaagacactgaagaaagcatcgtcctaggaatggatttctcctctaatgacagtagcacttgtaccatgggcttagttttgcctctctggagcgacacgctaattcatttggatggtgatggtgggttcagtgtatcgacggataacagagttcacatattcaaacctgtatctgtgcaggcaatgtgggttgacagggattcaaggaacaaacactgtgatgtactattggtggaagaatga
Sequence Length
537
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,492 Da
NCBI Official Full Name
Homo sapiens slingshot homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
slingshot protein phosphatase 2
NCBI Official Symbol
SSH2
NCBI Official Synonym Symbols
SSH-2; SSH-2L
NCBI Protein Information
protein phosphatase Slingshot homolog 2
UniProt Protein Name
Protein phosphatase Slingshot homolog 2
UniProt Gene Name
SSH2
UniProt Synonym Gene Names
KIAA1725; SSH2L; SSH-2L; hSSH-2L
UniProt Entry Name
SSH2_HUMAN

NCBI Description

This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

SSH2: Protein phosphatase which regulates actin filament dynamics. Dephosphorylates and activates the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Inhibitory phosphorylation of cofilin is mediated by LIMK1, which may also be dephosphorylated and inactivated by this protein. Belongs to the protein-tyrosine phosphatase family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Actin-binding; EC 3.1.3.48; EC 3.1.3.16; Protein phosphatase, dual-specificity

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: cytoplasm; extracellular space

Molecular Function: actin binding; phosphoprotein phosphatase activity

Biological Process: actin cytoskeleton organization and biogenesis; protein amino acid dephosphorylation; regulation of actin polymerization and/or depolymerization; regulation of axonogenesis

Research Articles on SSH2

Similar Products

Product Notes

The SSH2 ssh2 (Catalog #AAA1265683) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattcctt acttctccgc caacgcggtc atctcgcaga acgccatcaa ccagctcatc agcgagagct ttctaactgt caaaggtgct gccctttttc taccacgggg aaatggctca tccacaccaa gaatcagcca cagacggaac aagcatgcag gcgatctcca acagcatctc caagcaatgt tcattttact ccgcccagaa gacaacatca ggctggctgt aagactggaa agtacttacc agaatcgaac acgctatatg gtagtggttt caactaatgg tagacaagac actgaagaaa gcatcgtcct aggaatggat ttctcctcta atgacagtag cacttgtacc atgggcttag ttttgcctct ctggagcgac acgctaattc atttggatgg tgatggtggg ttcagtgtat cgacggataa cagagttcac atattcaaac ctgtatctgt gcaggcaatg tgggttgaca gggattcaag gaacaaacac tgtgatgtac tattggtgga agaatga. It is sometimes possible for the material contained within the vial of "SSH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.