Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINA1 cdna clone

SERPINA1 cDNA Clone

Gene Names
SERPINA1; PI; A1A; AAT; PI1; A1AT; PRO2275; alpha1AT
Synonyms
SERPINA1; SERPINA1 cDNA Clone; SERPINA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgtcttctgtctcgtggggcatcctcctgctggcaggcctgtgctgcctggtccctgtctccctggctgaggatccccagggagatgctgcccagaagacagatacatcccaccatgatcaggatcacccaaccttcaacaagatcacccccaacctggctgagttcgccttcagcctataccgccagctggcacaccagtccaacagcaccaatatcttcttctccccagtgagcatcgctacagcctttgcaatgctctccctggggaccaaggctgacactcacgatgaaatcctggagggcctgaatttcaacctcacggagattccggaggctcagatccatgaaggcttccaggaactcctccgtaccctcaaccagccagacagccagctccagctgaccaccggcaatggcttgttcctcagcgagggcctgaagctagtggataagtttttggaggatgttaaaaagttgtaccactcagaagccttcactgtcaacttcggggacaccgaagaggccaagaaacagatcaacgattacgtggagaagggtactcaagggaaaattgtggatttggtcaaggagcttgacagagacacagtttttgctctggtgaattacatcttctttaaaggcaaatgggagagaccctttgaagtcaaggacaccgaggaagaggacttccacgtggaccaggtgaccaccgtgaaggtgcctatgatgaagcgtttaggcatgtttaacatccagcactgtaagaagctgtccagctgggtgctgctgatgaaatacctgggcaatgccaccgccatcttcttcctgcctgatgaggggaaactacagcacctggaaaatgaactcacccacgatatcatcaccaagttcctggaaaatgaagacagaaggtctgccagcttacatttacccaaactgtccattactggaacctatgatctgaagagcgtcctgggtcaactgggcatcactaaggtcttcagcaatggggctgacctctccggggtcacagaggaggcacccctgaagctctccaaggccgtgcataaggctgtgctgaccatcgacgagaaagggactgaagctgctggggccatgtttttagaggccatacccatgtctatcccccccgaggtcaagttcaacaaaccctttgtcttcttaatgattgaccaaaataccaagtctcccctcttcatgggaaaagtggtgaatcccacccaaaaataa
Sequence Length
1257
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,755 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1, mRNA
NCBI Official Synonym Full Names
serpin family A member 1
NCBI Official Symbol
SERPINA1
NCBI Official Synonym Symbols
PI; A1A; AAT; PI1; A1AT; PRO2275; alpha1AT
NCBI Protein Information
alpha-1-antitrypsin
UniProt Protein Name
Alpha-1-antitrypsin
Protein Family
UniProt Gene Name
SERPINA1
UniProt Synonym Gene Names
AAT; PI; SPAAT
UniProt Entry Name
A1AT_HUMAN

NCBI Description

The protein encoded by this gene is secreted and is a serine protease inhibitor whose targets include elastase, plasmin, thrombin, trypsin, chymotrypsin, and plasminogen activator. Defects in this gene can cause emphysema or liver disease. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

SERPINA1: Inhibitor of serine proteases. Its primary target is elastase, but it also has a moderate affinity for plasmin and thrombin. Irreversibly inhibits trypsin, chymotrypsin and plasminogen activator. The aberrant form inhibits insulin-induced NO synthesis in platelets, decreases coagulation time and has proteolytic activity against insulin and plasmin. Defects in SERPINA1 are the cause of alpha-1-antitrypsin deficiency (A1ATD). A disorder whose most common manifestation is emphysema, which becomes evident by the third to fourth decade. A less common manifestation of the deficiency is liver disease, which occurs in children and adults, and may result in cirrhosis and liver failure. Environmental factors, particularly cigarette smoking, greatly increase the risk of emphysema at an earlier age. Belongs to the serpin family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Inhibitor; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 14q32.1

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen; ER to Golgi transport vesicle; ER-Golgi intermediate compartment membrane; extracellular region; extracellular space; Golgi apparatus

Molecular Function: glycoprotein binding; identical protein binding; protease binding; protein binding; serine-type endopeptidase inhibitor activity

Biological Process: COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; platelet degranulation

Disease: Alpha-1-antitrypsin Deficiency; Pulmonary Disease, Chronic Obstructive

Research Articles on SERPINA1

Similar Products

Product Notes

The SERPINA1 serpina1 (Catalog #AAA1265632) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgtctt ctgtctcgtg gggcatcctc ctgctggcag gcctgtgctg cctggtccct gtctccctgg ctgaggatcc ccagggagat gctgcccaga agacagatac atcccaccat gatcaggatc acccaacctt caacaagatc acccccaacc tggctgagtt cgccttcagc ctataccgcc agctggcaca ccagtccaac agcaccaata tcttcttctc cccagtgagc atcgctacag cctttgcaat gctctccctg gggaccaagg ctgacactca cgatgaaatc ctggagggcc tgaatttcaa cctcacggag attccggagg ctcagatcca tgaaggcttc caggaactcc tccgtaccct caaccagcca gacagccagc tccagctgac caccggcaat ggcttgttcc tcagcgaggg cctgaagcta gtggataagt ttttggagga tgttaaaaag ttgtaccact cagaagcctt cactgtcaac ttcggggaca ccgaagaggc caagaaacag atcaacgatt acgtggagaa gggtactcaa gggaaaattg tggatttggt caaggagctt gacagagaca cagtttttgc tctggtgaat tacatcttct ttaaaggcaa atgggagaga ccctttgaag tcaaggacac cgaggaagag gacttccacg tggaccaggt gaccaccgtg aaggtgccta tgatgaagcg tttaggcatg tttaacatcc agcactgtaa gaagctgtcc agctgggtgc tgctgatgaa atacctgggc aatgccaccg ccatcttctt cctgcctgat gaggggaaac tacagcacct ggaaaatgaa ctcacccacg atatcatcac caagttcctg gaaaatgaag acagaaggtc tgccagctta catttaccca aactgtccat tactggaacc tatgatctga agagcgtcct gggtcaactg ggcatcacta aggtcttcag caatggggct gacctctccg gggtcacaga ggaggcaccc ctgaagctct ccaaggccgt gcataaggct gtgctgacca tcgacgagaa agggactgaa gctgctgggg ccatgttttt agaggccata cccatgtcta tcccccccga ggtcaagttc aacaaaccct ttgtcttctt aatgattgac caaaatacca agtctcccct cttcatggga aaagtggtga atcccaccca aaaataa. It is sometimes possible for the material contained within the vial of "SERPINA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.