Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZUFSP cdna clone

ZUFSP cDNA Clone

Gene Names
ZUFSP; C6orf113; dJ412I7.3
Synonyms
ZUFSP; ZUFSP cDNA Clone; ZUFSP cdna clone
Ordering
For Research Use Only!
Sequence
atgctttcctgtaatatttgtggtgaaacagtaacctcagaaccagacatgaaagctcacctaattgttcacatggaaagtgaaattatatgtccattttgcaagttgtcaggtgtgaattatgatgaaatgtgttttcatatcgaaacagctcattttgagcagaatacacttgaaagaaactttgagaggataaatacagtacaatatggaacttcagataacaagaaagacaacaccctacagtgtggaatggaagttaattcaagtattctttcaggttgtgcatctaatcatccaaaaaattcagctcaaaacctgactaaagatagtactttaaaacatgaaggcttctattcagagaacttaactgaatctagaaaattcctgaaaagtagggaaaaacagtccagcctgaccgaaataaaaggatctgtttatgaaacaacatacagtcctcctgaatgtccattctgtggaaaaatagaggagcacagtgaagatatggaaactcatgtgaaaacaaagcatgccaatcttttagacattccattggaagactgtgatcaaccactctatgattgtcctatgtgtgggctcatatgtacaaattaccatattcttcaggaacatgttgacttgcatttggaagaaaacagctttcagcaaggcatggatagagtccagtgttctggtgatctacaattggctcaccagcttcagcaagaagaagacagaaagaggagatctgaagaatcaagacaagaaatagaagaatttcagaagctgcagagacaatatggtttagataattctggaggatacaaacaacaacaactacgaaatatggagatagaagtaaataggggaagaatgcctccatctgaatttcataggagaaaagctgatatgatggaatcattagctcttggttttgacgatggaaaaacaaaaacttccggaattattgaagcacttcataggtattatcagaatgctgccacagatgtgagacgggtgtggctttcttcagtggtggatcactttcattcatctttaggcgacaaaggttggggttgtggttacagaaatttccaaatgctactttcatcattattacaaaatgatgcttacaacgattgcttaaaaggtatgttgattccttgcattccaaaaattcaatctatgattgaagatgcatggaaggaaggttttgatcctcagggggcctctcaacttaataacaggttacagggaacaaaggcctggattggagcatgtgaagtatatatactcctgacctccctaagggtaaagtgtcatattgttgattttcacaaatcaactggtcctttgggtacacaccctcgcttatttgaatggatattgaactattattcttcagagggagaagggagtccaaaggtagtgtgtacatctaaacctcctatctatcttcagcatcaaggtcacagtcgaactgttattggaattgaagagaaaaaaaaccgaacattatgcttactaatacttgatcctggatgtccttctcgagaaatgcagaaattattaaagcaagacatagaggctagcagtctcaagcaacttcggaaatctatgggaaatttaaaacataagcaataccagatattggcagtagagggtgctctttctctagaggagaaacttgccaggagacaagcttctcaagtctttacagccgagaagattccttga
Sequence Length
1737
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
6,724 Da
NCBI Official Full Name
Homo sapiens zinc finger with UFM1-specific peptidase domain, mRNA
NCBI Official Synonym Full Names
zinc finger with UFM1 specific peptidase domain
NCBI Official Symbol
ZUFSP
NCBI Official Synonym Symbols
C6orf113; dJ412I7.3
NCBI Protein Information
zinc finger with UFM1-specific peptidase domain protein
UniProt Protein Name
Zinc finger with UFM1-specific peptidase domain protein
UniProt Gene Name
ZUFSP
UniProt Synonym Gene Names
C6orf113
UniProt Entry Name
ZUFSP_HUMAN

Uniprot Description

ZUFSP: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 6q22.1

Molecular Function: protein binding

Similar Products

Product Notes

The ZUFSP zufsp (Catalog #AAA1271065) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctttcct gtaatatttg tggtgaaaca gtaacctcag aaccagacat gaaagctcac ctaattgttc acatggaaag tgaaattata tgtccatttt gcaagttgtc aggtgtgaat tatgatgaaa tgtgttttca tatcgaaaca gctcattttg agcagaatac acttgaaaga aactttgaga ggataaatac agtacaatat ggaacttcag ataacaagaa agacaacacc ctacagtgtg gaatggaagt taattcaagt attctttcag gttgtgcatc taatcatcca aaaaattcag ctcaaaacct gactaaagat agtactttaa aacatgaagg cttctattca gagaacttaa ctgaatctag aaaattcctg aaaagtaggg aaaaacagtc cagcctgacc gaaataaaag gatctgttta tgaaacaaca tacagtcctc ctgaatgtcc attctgtgga aaaatagagg agcacagtga agatatggaa actcatgtga aaacaaagca tgccaatctt ttagacattc cattggaaga ctgtgatcaa ccactctatg attgtcctat gtgtgggctc atatgtacaa attaccatat tcttcaggaa catgttgact tgcatttgga agaaaacagc tttcagcaag gcatggatag agtccagtgt tctggtgatc tacaattggc tcaccagctt cagcaagaag aagacagaaa gaggagatct gaagaatcaa gacaagaaat agaagaattt cagaagctgc agagacaata tggtttagat aattctggag gatacaaaca acaacaacta cgaaatatgg agatagaagt aaatagggga agaatgcctc catctgaatt tcataggaga aaagctgata tgatggaatc attagctctt ggttttgacg atggaaaaac aaaaacttcc ggaattattg aagcacttca taggtattat cagaatgctg ccacagatgt gagacgggtg tggctttctt cagtggtgga tcactttcat tcatctttag gcgacaaagg ttggggttgt ggttacagaa atttccaaat gctactttca tcattattac aaaatgatgc ttacaacgat tgcttaaaag gtatgttgat tccttgcatt ccaaaaattc aatctatgat tgaagatgca tggaaggaag gttttgatcc tcagggggcc tctcaactta ataacaggtt acagggaaca aaggcctgga ttggagcatg tgaagtatat atactcctga cctccctaag ggtaaagtgt catattgttg attttcacaa atcaactggt cctttgggta cacaccctcg cttatttgaa tggatattga actattattc ttcagaggga gaagggagtc caaaggtagt gtgtacatct aaacctccta tctatcttca gcatcaaggt cacagtcgaa ctgttattgg aattgaagag aaaaaaaacc gaacattatg cttactaata cttgatcctg gatgtccttc tcgagaaatg cagaaattat taaagcaaga catagaggct agcagtctca agcaacttcg gaaatctatg ggaaatttaa aacataagca ataccagata ttggcagtag agggtgctct ttctctagag gagaaacttg ccaggagaca agcttctcaa gtctttacag ccgagaagat tccttga. It is sometimes possible for the material contained within the vial of "ZUFSP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.