Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZSCAN16 cdna clone

ZSCAN16 cDNA Clone

Gene Names
ZSCAN16; ZNF392; ZNF435; dJ265C24.3
Synonyms
ZSCAN16; ZSCAN16 cDNA Clone; ZSCAN16 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccacagccctggaacctgaggaccaaaaaggacttctgataattaaggcagaggaccattactggggacaggattccagctcacaaaagtgcagtcctcacaggagggaactctatagacaacacttcaggaagctctgctatcaggatgcacctggaccccgtgaagctcttacccagctgtgggagctctgccgtcagtggctgaggccagaatgccacaccaaggagcagattttagacctgctggtgctagaacagttcctgagcattcttcctaaagacctgcaagcatgggtgcgtgcacaccatccagagactggagaggaggcagtgacggtactggaggatctggagagagagcttgatgaacctggaaagcaggtcccaggcaattcagaaagacgggacatactcatggacaagttggcccccttgggaaggccatatgaatcactgactgtccagctccatcccaaaaagacccagctggagcaggaagctgggaaaccacaaaggaatggtgataaaactaggactaagaatgaagagttgttccagaaggaagatatgcccaaagacaaggaattccttggggagataaatgacagactgaacaaagatactcctcagcatcctaagtccaaagatattattgaaaatgagggcagatcagaatggcaacagagggaaagaagacgatataaatgtgatgaatgtgggaaaagtttcagtcatagctcagaccttagtaaacacaggagaactcacacgggagagaagccctataaatgtgatgagtgtggaaaagccttcattcagcgctcacatctcattggacatcatagagtacacacgggagtaaaaccctataaatgtaaagaatgtgggaaagacttcagtgggcgcacaggtcttattcagcatcagagaatccacacaggtgaaaaaccctatgaatgtgatgagtgtggaaggcctttccgagtaagttcagctcttattagacatcaaagaattcataccgcaaataaactctactaa
Sequence Length
1047
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,792 Da
NCBI Official Full Name
Homo sapiens zinc finger and SCAN domain containing 16, mRNA
NCBI Official Synonym Full Names
zinc finger and SCAN domain containing 16
NCBI Official Symbol
ZSCAN16
NCBI Official Synonym Symbols
ZNF392; ZNF435; dJ265C24.3
NCBI Protein Information
zinc finger and SCAN domain-containing protein 16
UniProt Protein Name
Zinc finger and SCAN domain-containing protein 16
UniProt Gene Name
ZSCAN16
UniProt Synonym Gene Names
ZNF392; ZNF435
UniProt Entry Name
ZSC16_HUMAN

Uniprot Description

ZSCAN16: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 6p22.1

Cellular Component: nucleus

Molecular Function: protein binding; sequence-specific DNA binding; transcription factor activity

Research Articles on ZSCAN16

Similar Products

Product Notes

The ZSCAN16 zscan16 (Catalog #AAA1268017) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccacag ccctggaacc tgaggaccaa aaaggacttc tgataattaa ggcagaggac cattactggg gacaggattc cagctcacaa aagtgcagtc ctcacaggag ggaactctat agacaacact tcaggaagct ctgctatcag gatgcacctg gaccccgtga agctcttacc cagctgtggg agctctgccg tcagtggctg aggccagaat gccacaccaa ggagcagatt ttagacctgc tggtgctaga acagttcctg agcattcttc ctaaagacct gcaagcatgg gtgcgtgcac accatccaga gactggagag gaggcagtga cggtactgga ggatctggag agagagcttg atgaacctgg aaagcaggtc ccaggcaatt cagaaagacg ggacatactc atggacaagt tggccccctt gggaaggcca tatgaatcac tgactgtcca gctccatccc aaaaagaccc agctggagca ggaagctggg aaaccacaaa ggaatggtga taaaactagg actaagaatg aagagttgtt ccagaaggaa gatatgccca aagacaagga attccttggg gagataaatg acagactgaa caaagatact cctcagcatc ctaagtccaa agatattatt gaaaatgagg gcagatcaga atggcaacag agggaaagaa gacgatataa atgtgatgaa tgtgggaaaa gtttcagtca tagctcagac cttagtaaac acaggagaac tcacacggga gagaagccct ataaatgtga tgagtgtgga aaagccttca ttcagcgctc acatctcatt ggacatcata gagtacacac gggagtaaaa ccctataaat gtaaagaatg tgggaaagac ttcagtgggc gcacaggtct tattcagcat cagagaatcc acacaggtga aaaaccctat gaatgtgatg agtgtggaag gcctttccga gtaagttcag ctcttattag acatcaaaga attcataccg caaataaact ctactaa. It is sometimes possible for the material contained within the vial of "ZSCAN16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.