Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF679 cdna clone

ZNF679 cDNA Clone

Synonyms
ZNF679; ZNF679 cDNA Clone; ZNF679 cdna clone
Ordering
For Research Use Only!
Sequence
atggctaaaagaccgggatcccctggaagccgagaaatgggactgttgacattcagagatgtagtcatagaattctctctggaggagtggcaatgcctggatcacgctcagcagaatttatatagagatgtgatgttagagaactacagaaacctggtctccctgggtattgctgtctctaagccagacttgatcacctgtctggagcaaaataaagagccttggaatataaagagaaatgagatggtaaccaaacacccagttatgtgttctcatttcacccaagaccttccgccagagctaggcataaaagattcactccaaaaagtaataccaagaagatatggaaaaagtggacatgacaatttacaagtaaaaacatgtaaaagcatgggtgagtgtgaggtgcaaaaaggaggttgtaatgaagttaaccaatgtttgtcaactacccaaaacaaaatatttcagactcataaatgtgtcaaagtcttcggcaaattttcaaattccaatagacataagacaagacatactggaaagaaacatttcaaatgtaaaaaatatggcaaatcattttgcatggtttcacaactacatcaacatcagataattcatactagggagaattcctaccaatgtgaagaatgcggcaaacccttcaactgctcttcaaccctttctaaacataaaagaattcatactggagagaaaccctacagatgtgaggaatgtggcaaagcttttacctggtcctcaacccttactaaacataggagaattcatactggagaaaaaccctacacatgtgaagaatgtggccaagcctttagccgctcctcaacacttgctaaccacaagagaattcatactggagagaaaccatacacatgtgaagaatgtggcaaagcctttagcttatcctcatccctcacttaccacaagagaattcatactggagagaaaccctacacatgtgaaaaatgtggcaaagcctttaactgctcctcaacccttaagaaacataagataattcatactggagagaaaccctacaaatgtaaagaatgtgggaaagcctttgccttctcctcaactcttaatactcataagaggattcatactggagaggaaccctacaaatgtgaagaatgtgacaaagcttttaagtggtcctcaagtcttgctaatcataagagtatgcatactggagagaaaccctacaaatgtgaataa
Sequence Length
1236
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,179 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 679, mRNA
NCBI Official Synonym Full Names
zinc finger protein 679
NCBI Official Symbol
ZNF679
NCBI Protein Information
zinc finger protein 679
UniProt Protein Name
Zinc finger protein 679
Protein Family
UniProt Gene Name
ZNF679
UniProt Entry Name
ZN679_HUMAN

Uniprot Description

ZNF679: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 7q11.21

Cellular Component: nucleus

Molecular Function: protein binding

Biological Process: regulation of transcription, DNA-dependent

Research Articles on ZNF679

Similar Products

Product Notes

The ZNF679 znf679 (Catalog #AAA1272569) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaaaa gaccgggatc ccctggaagc cgagaaatgg gactgttgac attcagagat gtagtcatag aattctctct ggaggagtgg caatgcctgg atcacgctca gcagaattta tatagagatg tgatgttaga gaactacaga aacctggtct ccctgggtat tgctgtctct aagccagact tgatcacctg tctggagcaa aataaagagc cttggaatat aaagagaaat gagatggtaa ccaaacaccc agttatgtgt tctcatttca cccaagacct tccgccagag ctaggcataa aagattcact ccaaaaagta ataccaagaa gatatggaaa aagtggacat gacaatttac aagtaaaaac atgtaaaagc atgggtgagt gtgaggtgca aaaaggaggt tgtaatgaag ttaaccaatg tttgtcaact acccaaaaca aaatatttca gactcataaa tgtgtcaaag tcttcggcaa attttcaaat tccaatagac ataagacaag acatactgga aagaaacatt tcaaatgtaa aaaatatggc aaatcatttt gcatggtttc acaactacat caacatcaga taattcatac tagggagaat tcctaccaat gtgaagaatg cggcaaaccc ttcaactgct cttcaaccct ttctaaacat aaaagaattc atactggaga gaaaccctac agatgtgagg aatgtggcaa agcttttacc tggtcctcaa cccttactaa acataggaga attcatactg gagaaaaacc ctacacatgt gaagaatgtg gccaagcctt tagccgctcc tcaacacttg ctaaccacaa gagaattcat actggagaga aaccatacac atgtgaagaa tgtggcaaag cctttagctt atcctcatcc ctcacttacc acaagagaat tcatactgga gagaaaccct acacatgtga aaaatgtggc aaagccttta actgctcctc aacccttaag aaacataaga taattcatac tggagagaaa ccctacaaat gtaaagaatg tgggaaagcc tttgccttct cctcaactct taatactcat aagaggattc atactggaga ggaaccctac aaatgtgaag aatgtgacaa agcttttaag tggtcctcaa gtcttgctaa tcataagagt atgcatactg gagagaaacc ctacaaatgt gaataa. It is sometimes possible for the material contained within the vial of "ZNF679, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.