Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF641 cdna clone

ZNF641 cDNA Clone

Synonyms
ZNF641; ZNF641 cDNA Clone; ZNF641 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagctgcacttcttgcggctggatcacagggcctggtaaccatcaaggatgtgtcactgtgcttctctcaggaggagtggcggagcctggacccctctcagacagacttttatggagaatatgtcatgcaggaaaactgtgggatagtagtctctctgagatttccaattcccaaactggacatgctttctcaactagaaggaggagaagaacaatgggtccctgacccccaggacttagaggagagggacattctgagggtcacatatacaggagatggaagtgaacatgagggggatacccctgaactagaagcagaacctcccagaatgttatccagcgtgtctgaagatactgttctctggaacccggagcatgatgagagctgggattccatgccctgcagctccagaggaatgctcctggggcccccttttcttcaggaagatagtttctcaaacctgctgtgtagcacagagatggattccctgttaagaccccacacatgcccccagtgtgggaaacagtttgtatggggttcccaccttgccaggcatcaacaaacacacactggggagagaccctacagctgcctcaagtgtgagaagacctttgggcgaagacatcacctcatcaggcaccagaaaacccacctacatgacaagaccagcaggtgctctgagtgtggtaagaatttccgatgcaactcccatctggccagccaccagagagtgcatgcagaaggcaaatcctgcaaaggccaagaggttggagagagccctggcacaaggaaacggcagcgtgccccaccagtgccaaagtgtcacgtgtgcactgaatgtgggaagagctttggccgaaggcaccaccttgtgagacactggctgacccacactggggagtag
Sequence Length
909
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,020 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 641, mRNA
NCBI Official Synonym Full Names
zinc finger protein 641
NCBI Official Symbol
ZNF641
NCBI Protein Information
zinc finger protein 641
UniProt Protein Name
Zinc finger protein 641
Protein Family
UniProt Gene Name
ZNF641
UniProt Entry Name
ZN641_HUMAN

Uniprot Description

ZNF641: Transcriptional activatior. Activates transcriptional activities of SRE and AP-1. Belongs to the krueppel C2H2-type zinc-finger protein family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 12q13.11

Cellular Component: cytoplasm; nucleoplasm; nucleus

Similar Products

Product Notes

The ZNF641 znf641 (Catalog #AAA1273728) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagctg cacttcttgc ggctggatca cagggcctgg taaccatcaa ggatgtgtca ctgtgcttct ctcaggagga gtggcggagc ctggacccct ctcagacaga cttttatgga gaatatgtca tgcaggaaaa ctgtgggata gtagtctctc tgagatttcc aattcccaaa ctggacatgc tttctcaact agaaggagga gaagaacaat gggtccctga cccccaggac ttagaggaga gggacattct gagggtcaca tatacaggag atggaagtga acatgagggg gatacccctg aactagaagc agaacctccc agaatgttat ccagcgtgtc tgaagatact gttctctgga acccggagca tgatgagagc tgggattcca tgccctgcag ctccagagga atgctcctgg ggcccccttt tcttcaggaa gatagtttct caaacctgct gtgtagcaca gagatggatt ccctgttaag accccacaca tgcccccagt gtgggaaaca gtttgtatgg ggttcccacc ttgccaggca tcaacaaaca cacactgggg agagacccta cagctgcctc aagtgtgaga agacctttgg gcgaagacat cacctcatca ggcaccagaa aacccaccta catgacaaga ccagcaggtg ctctgagtgt ggtaagaatt tccgatgcaa ctcccatctg gccagccacc agagagtgca tgcagaaggc aaatcctgca aaggccaaga ggttggagag agccctggca caaggaaacg gcagcgtgcc ccaccagtgc caaagtgtca cgtgtgcact gaatgtggga agagctttgg ccgaaggcac caccttgtga gacactggct gacccacact ggggagtag. It is sometimes possible for the material contained within the vial of "ZNF641, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.