Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF513 cdna clone

ZNF513 cDNA Clone

Gene Names
ZNF513; RP58; HMFT0656
Synonyms
ZNF513; ZNF513 cDNA Clone; ZNF513 cdna clone
Ordering
For Research Use Only!
Sequence
atgccccgaaggaagcaaagccacccgcagcccgtgaaatgcgagggggtcaaagtggatactgaagactccctcgacgaaggacccggggccctggtattggagagtgatttgctactaggccaggatctggagtttgaggaggaagaggaagaggaggaaggcgacggcaacagtgaccagctcatgggcttcgagagagactcggaaggagactctctgggggccaggcctgggcttccctatgggctgagcgacgatgagtctgggggcggccgggcactaagtgcggagagtgaagttgaggagccagccaggggtccaggggaggccaggggtgagaggccaggcccagcctgccagctgtgtggggggccgacaggtgaggggccgtgttgtggggcaggagggccgggtggggggcccctgctgcccccacggctactgtactcatgccgcctctgcaccttcgtgtcccactactcgagccacctgaagcggcacatgcagacacacagcggagagaagccgttccgctgtggccgctgcccctacgcctcagcccagctcgtcaacctgacacgacatacccgcacccacactggcgagaagccctaccgctgtccccactgcccctttgcctgcagcagcctgggcaacctgaggcggcatcagcgtacccacgcagggccccccactcctccctgcccgacctgtggcttccgctgctgtactccacgaccagcccggcctcccagtcccacagagcaggagggggcggtgccccggcgacctgaagatgctctgctccttccagatttgagcctccatgtgccaccaggtggtgccagtttcctgccagactgtgggcagctgcggggtgaaggggagggcctctgcgggactggatcagaaccactgccagagctgctattcccttggacctgccggggctgtggacaagagctggaggagggtgagggtagtcggctgggagctgccatgtgtgggcgctgcatgcgaggagaggctggagggggtgccagtggggggccccagggccccagtgacaaaggctttgcctgtagcctctgcccctttgccactcactatcccaaccacctggcccggcacatgaagacacacagtggtgagaagcccttccgctgcgcccgctgtccttatgcctctgctcatctggataacctgaaacggcaccagcgcgtccatacaggagagaagccctacaagtgccccctctgcccttatgcctgtggcaatctggccaacctcaagcgtcatggtcgcatccactctggtgacaaaccttttcggtgtagcctttgcaactacagctgcaaccagagcatgaacctcaaacgtcacatgctgcggcacacaggcgagaagcccttccgctgtgccacctgcgcctataccacgggccactgggacaactacaagcgccaccagaaggtgcatggccacggtggggcaggagggcctggtctctctgcctctgagggctgggccccacctcatagcccaccctctgttttgagctctcggggcccaccagccctggggactgctggcagccgggctgtccacacagactcatcctga
Sequence Length
1626
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,352 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 513, mRNA
NCBI Official Synonym Full Names
zinc finger protein 513
NCBI Official Symbol
ZNF513
NCBI Official Synonym Symbols
RP58; HMFT0656
NCBI Protein Information
zinc finger protein 513
UniProt Protein Name
Zinc finger protein 513
Protein Family
UniProt Gene Name
ZNF513
UniProt Entry Name
ZN513_HUMAN

NCBI Description

The protein encoded by this gene is a possible transcriptional regulator involved in retinal development. Defects in this gene can be a cause of autosomal-recessive retinitis pigmentosa. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]

Uniprot Description

ZNF513: Transcriptional regulator that plays a role in retinal development and maintenance. Defects in ZNF513 are the cause of retinitis pigmentosa type 58 (RP58). A retinal dystrophy belonging to the group of pigmentary retinopathies. Retinitis pigmentosa is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. Belongs to the krueppel C2H2-type zinc-finger protein family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 2p23.3

Cellular Component: nucleus

Molecular Function: DNA binding; protein binding

Biological Process: retina development in camera-type eye

Disease: Retinitis Pigmentosa 58

Research Articles on ZNF513

Similar Products

Product Notes

The ZNF513 znf513 (Catalog #AAA1276165) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccgaa ggaagcaaag ccacccgcag cccgtgaaat gcgagggggt caaagtggat actgaagact ccctcgacga aggacccggg gccctggtat tggagagtga tttgctacta ggccaggatc tggagtttga ggaggaagag gaagaggagg aaggcgacgg caacagtgac cagctcatgg gcttcgagag agactcggaa ggagactctc tgggggccag gcctgggctt ccctatgggc tgagcgacga tgagtctggg ggcggccggg cactaagtgc ggagagtgaa gttgaggagc cagccagggg tccaggggag gccaggggtg agaggccagg cccagcctgc cagctgtgtg gggggccgac aggtgagggg ccgtgttgtg gggcaggagg gccgggtggg gggcccctgc tgcccccacg gctactgtac tcatgccgcc tctgcacctt cgtgtcccac tactcgagcc acctgaagcg gcacatgcag acacacagcg gagagaagcc gttccgctgt ggccgctgcc cctacgcctc agcccagctc gtcaacctga cacgacatac ccgcacccac actggcgaga agccctaccg ctgtccccac tgcccctttg cctgcagcag cctgggcaac ctgaggcggc atcagcgtac ccacgcaggg ccccccactc ctccctgccc gacctgtggc ttccgctgct gtactccacg accagcccgg cctcccagtc ccacagagca ggagggggcg gtgccccggc gacctgaaga tgctctgctc cttccagatt tgagcctcca tgtgccacca ggtggtgcca gtttcctgcc agactgtggg cagctgcggg gtgaagggga gggcctctgc gggactggat cagaaccact gccagagctg ctattccctt ggacctgccg gggctgtgga caagagctgg aggagggtga gggtagtcgg ctgggagctg ccatgtgtgg gcgctgcatg cgaggagagg ctggaggggg tgccagtggg gggccccagg gccccagtga caaaggcttt gcctgtagcc tctgcccctt tgccactcac tatcccaacc acctggcccg gcacatgaag acacacagtg gtgagaagcc cttccgctgc gcccgctgtc cttatgcctc tgctcatctg gataacctga aacggcacca gcgcgtccat acaggagaga agccctacaa gtgccccctc tgcccttatg cctgtggcaa tctggccaac ctcaagcgtc atggtcgcat ccactctggt gacaaacctt ttcggtgtag cctttgcaac tacagctgca accagagcat gaacctcaaa cgtcacatgc tgcggcacac aggcgagaag cccttccgct gtgccacctg cgcctatacc acgggccact gggacaacta caagcgccac cagaaggtgc atggccacgg tggggcagga gggcctggtc tctctgcctc tgagggctgg gccccacctc atagcccacc ctctgttttg agctctcggg gcccaccagc cctggggact gctggcagcc gggctgtcca cacagactca tcctga. It is sometimes possible for the material contained within the vial of "ZNF513, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.