ZNF503 cdna clone
ZNF503 cDNA Clone
Gene Names
ZNF503; Nlz2; NOLZ1; NOLZ-1
Synonyms
ZNF503; ZNF503 cDNA Clone; ZNF503 cdna clone
Sequence
atgagcacagcgccctcgctttctgccctaagaagcagtaagcacagcggcggcggcggcggcggaggcggaggcggcggtgcagaccctgcctggaccagcgcgctctctggaaatagctccggccccggcccaggctcgtccccggccggcagcaccaagccttttgtgcacgccgtgcccccctctgaccccctgcgccaggccaaccgcctgccaatcaaggtgctgaagatgctgacggcacgaactggccacattttgcaccccgagtacctgcagcccctgccttccacgccggtcagccccatcgagctcgatgccaagaagagcccgctggcgctgttggcgcaaacatgttcgcagatcgggaagcccgacccctcgccctcctccaaactctcctcggttgcctccaacgggggcggcgcgggcggtgccggcggcggtgctgcgggcgacaaggacaccaaatcgggccccctgaagctgagcgacatcggcgtggaggacaagtcgagtttcaagccgtactccaaacccggctcggataagaaggagccgggaggcggcggtggaggcggtggcggtggcgggggcggcggcgggggtgtttcgtcggagaagtcgggattccgggtaccgagcgccacctgccagccattcacgcccaggacaggcagcccgagctccagcgcctcggcctgctcgccgggaggtatgctgtcctcggccgggggtgccccggagggcaaggacgacaagaaagacaccgacgtgggcggcggtggcaagggcaccgggggcgcctcggccgaagggggacccacggggctggcacacggccggattagctgcggcggcgggattaatgtggatgtgaaccagcatccggatgggggcccgggaggcaaggctctgggctcggactgcggcggttcatcgggctccagctccggctccggccccagcgcgcccacctcctcctcagtgttgggctctgggctggtggctcccgtgtcaccctacaagccgggccagacagtgttccctctgcctcccgcgggtatgacctacccaggcagcctggccggggcctacgccggctacccgccccagttcctgccacacggcgtggcacttgaccccaccaagccgggcagcctggtgggggcgcagctggcggcggccgcggccgggtctctgggctgcagtaagccggccggctccagtcctttggccggagcgtctccgccgtccgtgatgacagccagtttgtgccgggacccttactgcctcagctaccactgcgctagccacctggcaggggcggcggccgccagcgcttcttgcgcacatgatccggctgctgcggctgcggcgctgaagtccggatacccgctggtgtaccccacgcacccgctgcacggtgtgcactcctcgctaacggccgccgcggctgctggcgccacaccgccctccctggccggccaccccctctacccctacggctttatgctccctaacgacccactcccccacatctgcaactgggtgtcggccaacgggccgtgcgacaagcgcttcgccacgtccgaagagctgctgagccacttgcggacccatacggcatttcccgggacagacaaactgctgtcgggctaccccagctcgtcgtctctggccagcgctgccgcggccgccatggcttgccacatgcacatccccacctcgggcgcaccgggcagccctgggacgctggcgctgcgcagcccccaccacgcgctgggactcagcagccgctaccacccctactccaagagcccgcttcccacgcctggcgcccccgtgccggtgcccgccgccaccggaccgtactactccccctacgccctctacggacagagactgaccaccgcctcggcgctggggtatcagtga
Sequence Length
1941
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,924 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 503, mRNA
NCBI Official Synonym Full Names
zinc finger protein 503
NCBI Official Symbol
ZNF503
NCBI Official Synonym Symbols
Nlz2; NOLZ1; NOLZ-1
NCBI Protein Information
zinc finger protein 503
UniProt Protein Name
Zinc finger protein 503
Protein Family
UniProt Gene Name
ZNF503
UniProt Synonym Gene Names
NOLZ1
UniProt Entry Name
ZN503_HUMAN
Uniprot Description
ZNF503: May function as a transcriptional repressor. Belongs to the Elbow/Noc family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Motility/polarity/chemotaxis; C2H2-type zinc finger protein; Transcription regulation
Chromosomal Location of Human Ortholog: 10q22.2
Biological Process: negative regulation of cell proliferation
Similar Products
Product Notes
The ZNF503 znf503 (Catalog #AAA1274565) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcacag cgccctcgct ttctgcccta agaagcagta agcacagcgg cggcggcggc ggcggaggcg gaggcggcgg tgcagaccct gcctggacca gcgcgctctc tggaaatagc tccggccccg gcccaggctc gtccccggcc ggcagcacca agccttttgt gcacgccgtg cccccctctg accccctgcg ccaggccaac cgcctgccaa tcaaggtgct gaagatgctg acggcacgaa ctggccacat tttgcacccc gagtacctgc agcccctgcc ttccacgccg gtcagcccca tcgagctcga tgccaagaag agcccgctgg cgctgttggc gcaaacatgt tcgcagatcg ggaagcccga cccctcgccc tcctccaaac tctcctcggt tgcctccaac gggggcggcg cgggcggtgc cggcggcggt gctgcgggcg acaaggacac caaatcgggc cccctgaagc tgagcgacat cggcgtggag gacaagtcga gtttcaagcc gtactccaaa cccggctcgg ataagaagga gccgggaggc ggcggtggag gcggtggcgg tggcgggggc ggcggcgggg gtgtttcgtc ggagaagtcg ggattccggg taccgagcgc cacctgccag ccattcacgc ccaggacagg cagcccgagc tccagcgcct cggcctgctc gccgggaggt atgctgtcct cggccggggg tgccccggag ggcaaggacg acaagaaaga caccgacgtg ggcggcggtg gcaagggcac cgggggcgcc tcggccgaag ggggacccac ggggctggca cacggccgga ttagctgcgg cggcgggatt aatgtggatg tgaaccagca tccggatggg ggcccgggag gcaaggctct gggctcggac tgcggcggtt catcgggctc cagctccggc tccggcccca gcgcgcccac ctcctcctca gtgttgggct ctgggctggt ggctcccgtg tcaccctaca agccgggcca gacagtgttc cctctgcctc ccgcgggtat gacctaccca ggcagcctgg ccggggccta cgccggctac ccgccccagt tcctgccaca cggcgtggca cttgacccca ccaagccggg cagcctggtg ggggcgcagc tggcggcggc cgcggccggg tctctgggct gcagtaagcc ggccggctcc agtcctttgg ccggagcgtc tccgccgtcc gtgatgacag ccagtttgtg ccgggaccct tactgcctca gctaccactg cgctagccac ctggcagggg cggcggccgc cagcgcttct tgcgcacatg atccggctgc tgcggctgcg gcgctgaagt ccggataccc gctggtgtac cccacgcacc cgctgcacgg tgtgcactcc tcgctaacgg ccgccgcggc tgctggcgcc acaccgccct ccctggccgg ccaccccctc tacccctacg gctttatgct ccctaacgac ccactccccc acatctgcaa ctgggtgtcg gccaacgggc cgtgcgacaa gcgcttcgcc acgtccgaag agctgctgag ccacttgcgg acccatacgg catttcccgg gacagacaaa ctgctgtcgg gctaccccag ctcgtcgtct ctggccagcg ctgccgcggc cgccatggct tgccacatgc acatccccac ctcgggcgca ccgggcagcc ctgggacgct ggcgctgcgc agcccccacc acgcgctggg actcagcagc cgctaccacc cctactccaa gagcccgctt cccacgcctg gcgcccccgt gccggtgccc gccgccaccg gaccgtacta ctccccctac gccctctacg gacagagact gaccaccgcc tcggcgctgg ggtatcagtg a. It is sometimes possible for the material contained within the vial of "ZNF503, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
