ZNF323 cdna clone
ZNF323 cDNA Clone
Gene Names
ZSCAN31; ZNF323; ZNF310P; ZNF20-Lp
Synonyms
ZNF323; ZNF323 cDNA Clone; ZNF323 cdna clone
Sequence
atggtgacacagctcagatatgaatctttttgcctccaccaatttcaagaacaagatggtgaaagtatacctgagaaccaggagttggcatcaaagcaagaaatcttaaaagaaatggaacatttgggggatagcaaactccaaagagatgtatctttggattctaagtacagagaaacttgtaaacgagacagcaaggcagaaaagcagcaggcacattccactggagagagacgccacaggtgcaatgaatgtgggaaaagcttcactaagagttcagtactcattgagcaccagagaatccacactggggagaagccatatgaatgtgaagaatgtgggaaggccttcagccggaggtcaagcctgaatgaacatcggcggagccacactggagagaaaccctatcaatgtaaggagtgtgggaaagccttcagtgccagcaatggcctcactcgacacagaagaatccacacaggggaaaaaccatatgaatgcaaagtgtgtgggaaggctttcctcctcagctcatgccttgttcagcatcagaggatacacactggagagaagcgctatcagtgtcgtgagtgtggcaaagccttcattcagaatgcagggcttttccagcatctccgagtccacactggtgagaaaccctatcagtgcagtcagtgcagtaaactctttagtaagcggacacttcttaagaaacatcagaaaatccacactggagagagaccataa
Sequence Length
744
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,711 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 323, mRNA
NCBI Official Synonym Full Names
zinc finger and SCAN domain containing 31
NCBI Official Symbol
ZSCAN31
NCBI Official Synonym Symbols
ZNF323; ZNF310P; ZNF20-Lp
NCBI Protein Information
zinc finger and SCAN domain-containing protein 31
UniProt Protein Name
Zinc finger and SCAN domain-containing protein 31
UniProt Gene Name
ZSCAN31
UniProt Synonym Gene Names
ZNF310P; ZNF323
UniProt Entry Name
ZSC31_HUMAN
NCBI Description
This gene encodes a protein containing multiple C2H2-type zinc finger motifs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Uniprot Description
ZNF323: May function as a transcription factor. May be involved in the development of multiple embryonic organs. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein; DNA-binding
Chromosomal Location of Human Ortholog: 6p21.31|6p22.3-p22.1
Cellular Component: nucleus
Molecular Function: sequence-specific DNA binding; transcription factor activity
Research Articles on ZNF323
Similar Products
Product Notes
The ZNF323 zscan31 (Catalog #AAA1266503) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgacac agctcagata tgaatctttt tgcctccacc aatttcaaga acaagatggt gaaagtatac ctgagaacca ggagttggca tcaaagcaag aaatcttaaa agaaatggaa catttggggg atagcaaact ccaaagagat gtatctttgg attctaagta cagagaaact tgtaaacgag acagcaaggc agaaaagcag caggcacatt ccactggaga gagacgccac aggtgcaatg aatgtgggaa aagcttcact aagagttcag tactcattga gcaccagaga atccacactg gggagaagcc atatgaatgt gaagaatgtg ggaaggcctt cagccggagg tcaagcctga atgaacatcg gcggagccac actggagaga aaccctatca atgtaaggag tgtgggaaag ccttcagtgc cagcaatggc ctcactcgac acagaagaat ccacacaggg gaaaaaccat atgaatgcaa agtgtgtggg aaggctttcc tcctcagctc atgccttgtt cagcatcaga ggatacacac tggagagaag cgctatcagt gtcgtgagtg tggcaaagcc ttcattcaga atgcagggct tttccagcat ctccgagtcc acactggtga gaaaccctat cagtgcagtc agtgcagtaa actctttagt aagcggacac ttcttaagaa acatcagaaa atccacactg gagagagacc ataa. It is sometimes possible for the material contained within the vial of "ZNF323, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
