ZNF300 cdna clone
ZNF300 cDNA Clone
Synonyms
ZNF300; ZNF300 cDNA Clone; ZNF300 cdna clone
Sequence
atgatgaagtcccaggggttagtatcattcaaggatgtggctgtggatttcacccaggaggagtggcagcaacttgacccttctcagaggaccctgtacagggatgtgatgctggagaactacagccacctggtctcaatggggtatccagtttccaaaccagatgtcatctccaagttggaacaaggagaagagccatggatcataaagggagacatatcaaattggatctatccagatgaatatcaggcagatgggagacaagacaggaagagtaaccttcacaactcccagtcatgtattttggggacagtttccttccatcataagatactgaaaggagtcacaagggatggttcattgtgctccattttaaaagtctgtcaaggtgatggtcagctgcagagatttctagagaatcaagacaaactcttcaggcaggtcacatttgttaacagcaaaacagtgactgaggcatcagggcataaatataatccactggggaaaatatttcaagagtgcatagaaacagatatatcaatacagagattccataaatatgatgcttttaaaaagaacttaaaaccaaatattgacctaccgagttgttataagagcaattcaagaaaaaaacctgatcagagttttggaggtggaaaatcatctagccagagtgagcccaattctaatcttgagaagattcacaatggagtaataccttttgatgataatcagtgtggaaacgtttttagaaatacacaatcccttattcaatatcagaatgtggaaactaaagagaaaagctgtgtatgtgttacatgtggaaaagcctttgctaagaagtcacaactcattgtacatcaaagaattcatactggaaagaaaccatatgattgtggtgcatgcggaaaagccttcagtgagaagtttcatcttgttgtacatcagagaactcatactggggagaaaccttatgattgttctgaatgtggaaaagccttctctcagaaatcgtcccttattatacatcagagagttcacactggggaaaaaccctatgaatgtagtgaatgcgggaaagccttctcccagaaatcacccctcattatacatcagagaatacatactggggaaaaaccctatgaatgtagagagtgtgggaaggccttttcccagaagtcacagctgattatacaccacagagctcatactggagagaagccgtatgagtgtaccgaatgtgggaaagccttctgtgagaagtcccacctcattatacataaaagaattcacactggtgagaaaccctacaaatgtgctcaatgtgaggaagccttcagcaggaagacagaactcattacacatcagttagttcatactggggaaaaaccttatgaatgtactgaatgtggaaagacattctcccgcaagtcacagctcatcatacatcagagaacacatactggagaaaaaccctataaatgtagtgaatgtggcaaagccttctgccagaagtcacatctcattggacatcagagaattcacacaggagaaaaaccttatatatgtactgaatgtgggaaagccttctctcagaagtcccaccttccgggacaccagcgaattcatacaggagagaaaccttacatatgtgctgaatgtggaaaggccttttctcagaagtcagaccttgttttacatcagaggattcatactggggaaagaccctatcaatgtgctatatgtgggaaggccttcatccagaagtcacaactaactgtacaccagagaattcacacagtggtaaaatcataa
Sequence Length
1815
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
64,484 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 300, mRNA
NCBI Official Synonym Full Names
zinc finger protein 300
NCBI Official Symbol
ZNF300
NCBI Protein Information
zinc finger protein 300
UniProt Protein Name
Zinc finger protein 300
Protein Family
UniProt Gene Name
ZNF300
UniProt Entry Name
ZN300_HUMAN
NCBI Description
The protein encoded by this gene is a C2H2-type zinc finger DNA binding protein and likely transcriptional regulator. The function of this protein is not yet known. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2010]
Uniprot Description
ZNF300: Has a transcriptional repressor activity. Belongs to the krueppel C2H2-type zinc-finger protein family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription factor; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 5q33.1
Cellular Component: nucleus
Molecular Function: protein binding; transcription factor activity
Biological Process: regulation of transcription, DNA-dependent
Research Articles on ZNF300
Similar Products
Product Notes
The ZNF300 znf300 (Catalog #AAA1278558) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgaagt cccaggggtt agtatcattc aaggatgtgg ctgtggattt cacccaggag gagtggcagc aacttgaccc ttctcagagg accctgtaca gggatgtgat gctggagaac tacagccacc tggtctcaat ggggtatcca gtttccaaac cagatgtcat ctccaagttg gaacaaggag aagagccatg gatcataaag ggagacatat caaattggat ctatccagat gaatatcagg cagatgggag acaagacagg aagagtaacc ttcacaactc ccagtcatgt attttgggga cagtttcctt ccatcataag atactgaaag gagtcacaag ggatggttca ttgtgctcca ttttaaaagt ctgtcaaggt gatggtcagc tgcagagatt tctagagaat caagacaaac tcttcaggca ggtcacattt gttaacagca aaacagtgac tgaggcatca gggcataaat ataatccact ggggaaaata tttcaagagt gcatagaaac agatatatca atacagagat tccataaata tgatgctttt aaaaagaact taaaaccaaa tattgaccta ccgagttgtt ataagagcaa ttcaagaaaa aaacctgatc agagttttgg aggtggaaaa tcatctagcc agagtgagcc caattctaat cttgagaaga ttcacaatgg agtaatacct tttgatgata atcagtgtgg aaacgttttt agaaatacac aatcccttat tcaatatcag aatgtggaaa ctaaagagaa aagctgtgta tgtgttacat gtggaaaagc ctttgctaag aagtcacaac tcattgtaca tcaaagaatt catactggaa agaaaccata tgattgtggt gcatgcggaa aagccttcag tgagaagttt catcttgttg tacatcagag aactcatact ggggagaaac cttatgattg ttctgaatgt ggaaaagcct tctctcagaa atcgtccctt attatacatc agagagttca cactggggaa aaaccctatg aatgtagtga atgcgggaaa gccttctccc agaaatcacc cctcattata catcagagaa tacatactgg ggaaaaaccc tatgaatgta gagagtgtgg gaaggccttt tcccagaagt cacagctgat tatacaccac agagctcata ctggagagaa gccgtatgag tgtaccgaat gtgggaaagc cttctgtgag aagtcccacc tcattataca taaaagaatt cacactggtg agaaacccta caaatgtgct caatgtgagg aagccttcag caggaagaca gaactcatta cacatcagtt agttcatact ggggaaaaac cttatgaatg tactgaatgt ggaaagacat tctcccgcaa gtcacagctc atcatacatc agagaacaca tactggagaa aaaccctata aatgtagtga atgtggcaaa gccttctgcc agaagtcaca tctcattgga catcagagaa ttcacacagg agaaaaacct tatatatgta ctgaatgtgg gaaagccttc tctcagaagt cccaccttcc gggacaccag cgaattcata caggagagaa accttacata tgtgctgaat gtggaaaggc cttttctcag aagtcagacc ttgttttaca tcagaggatt catactgggg aaagacccta tcaatgtgct atatgtggga aggccttcat ccagaagtca caactaactg tacaccagag aattcacaca gtggtaaaat cataa. It is sometimes possible for the material contained within the vial of "ZNF300, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
