ZNF24 cdna clone
ZNF24 cDNA Clone
Gene Names
ZNF24; KOX17; RSG-A; ZNF191; ZSCAN3; Zfp191
Synonyms
ZNF24; ZNF24 cDNA Clone; ZNF24 cdna clone
Sequence
atgtctgcacagtcagtggaagaagattcaatacttatcatcccaactccagatgaagaggaaaaaattctgagagtgaagttggaggaggatcctgatggcgaagagggatcaagtatcccctggaaccatctcccagacccagagattttccgacagcgattcaggcagtttggataccaggattcacctgggccccgtgaggctgtgagccagctccgagaactttgccgtctgtggctcaggccagagacgcacacaaaagaacaaatcttggagctggtagtgctggagcagtttgttgccatcctacccaaagagctacagacttgggttcgagatcatcatccagagaatggagaggaggcagtgacagtgctggaggatttggagagtgaacttgatgaccctggacaaccggtttctctccgtcgacgaaaacgggaagtactagtagaagacatggtatctcaagaagaagctcagggattaccaagttctgagcttgatgctgtggagaaccagctcaagtgggcatcctgggagctccattccctaaggcactgtgatgatgatggtaggactgaaaatggagcactagctccaaagcaggagcttccttcagcattagaatcccatgaagttcctggcactctcagtatgggtgttcctcaaatttttaaatatggagaaacctgtttccccaagggcaggtttgaaagaaagagaaatccctctcgaaagaaacaacatatatgtgatgaatgtggaaaacacttcagtcagggctcagcccttattcttcatcaaagaattcacagtggggagaaaccttatggatgtgttgagtgtgggaaagcattcagccgaagttccattcttgtgcaacaccagagagtccacactggagaaaaaccttacaaatgtcttgaatgtgggaaagcctttagccagaattcggggcttattaatcatcagagaatccatactggggagaaaccttatgaatgcgttcagtgtgggaaatcgtatagtcaaagctcaaatctttttagacatcagagaagacacaatgcagaaaaacttctgaatgttgtgaaagtttaa
Sequence Length
1107
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,382 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 24, mRNA
NCBI Official Synonym Full Names
zinc finger protein 24
NCBI Official Symbol
ZNF24
NCBI Official Synonym Symbols
KOX17; RSG-A; ZNF191; ZSCAN3; Zfp191
NCBI Protein Information
zinc finger protein 24
UniProt Protein Name
Zinc finger protein 24
Protein Family
UniProt Gene Name
ZNF24
UniProt Synonym Gene Names
KOX17; ZNF191; ZSCAN3; RSG-A
UniProt Entry Name
ZNF24_HUMAN
Uniprot Description
ZNF24: a probable transcriptional regulator of the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein; DNA-binding; Transcription factor
Chromosomal Location of Human Ortholog: 18q12
Cellular Component: nucleus
Molecular Function: DNA binding; protein binding; sequence-specific DNA binding; transcription factor activity
Biological Process: myelination; negative regulation of transcription, DNA-dependent
Research Articles on ZNF24
Similar Products
Product Notes
The ZNF24 znf24 (Catalog #AAA1275503) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgcac agtcagtgga agaagattca atacttatca tcccaactcc agatgaagag gaaaaaattc tgagagtgaa gttggaggag gatcctgatg gcgaagaggg atcaagtatc ccctggaacc atctcccaga cccagagatt ttccgacagc gattcaggca gtttggatac caggattcac ctgggccccg tgaggctgtg agccagctcc gagaactttg ccgtctgtgg ctcaggccag agacgcacac aaaagaacaa atcttggagc tggtagtgct ggagcagttt gttgccatcc tacccaaaga gctacagact tgggttcgag atcatcatcc agagaatgga gaggaggcag tgacagtgct ggaggatttg gagagtgaac ttgatgaccc tggacaaccg gtttctctcc gtcgacgaaa acgggaagta ctagtagaag acatggtatc tcaagaagaa gctcagggat taccaagttc tgagcttgat gctgtggaga accagctcaa gtgggcatcc tgggagctcc attccctaag gcactgtgat gatgatggta ggactgaaaa tggagcacta gctccaaagc aggagcttcc ttcagcatta gaatcccatg aagttcctgg cactctcagt atgggtgttc ctcaaatttt taaatatgga gaaacctgtt tccccaaggg caggtttgaa agaaagagaa atccctctcg aaagaaacaa catatatgtg atgaatgtgg aaaacacttc agtcagggct cagcccttat tcttcatcaa agaattcaca gtggggagaa accttatgga tgtgttgagt gtgggaaagc attcagccga agttccattc ttgtgcaaca ccagagagtc cacactggag aaaaacctta caaatgtctt gaatgtggga aagcctttag ccagaattcg gggcttatta atcatcagag aatccatact ggggagaaac cttatgaatg cgttcagtgt gggaaatcgt atagtcaaag ctcaaatctt tttagacatc agagaagaca caatgcagaa aaacttctga atgttgtgaa agtttaa. It is sometimes possible for the material contained within the vial of "ZNF24, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
