ZNF212 cdna clone
ZNF212 cDNA Clone
Gene Names
ZNF212; ZNF182; ZNFC150; C2H2-150
Synonyms
ZNF212; ZNF212 cDNA Clone; ZNF212 cdna clone
Sequence
atggcggagtcggcgcctgctcggcacaggagaaaacgacgctccacacctttaacttcttccacacttccttcacaagcaacagagaaaagctcctattttcagaccaccgagatttcactctggacggtggtggccgctattcaggctgtggagaagaagatggagtcccaggctgcccggctacagagcctggaggggcgcacggggacagccgagaagaagctggctgactgcgagaagatggccgtggagttcgggaaccagctggagggcaagtgggccgtgctggggaccctgctgcaggagtatgggctactgcagaggcggctggagaacgtggagaacctgctgcgcaacaggaacttctggatcctgcggctgcccccgggcagcaagggggaggcccccaaggtgtccaggtcactggagaatgatggcgtctgtttcaccgagcaggaatgggagaatctggaggattggcagaaggagctctacagaaacgtgatggagagtaactatgagacactggtctctctgaaggtccttggccagacagagggagaagcggagttgggtacagagatgctgggtgacttggaagaggaaggtcctggtggtgcccacccagcaggtggggtcatgatcaaacaggagctacagtatacacaggaaggccctgcggatcttcctggagagttctcatgcattgctgaagagcaggctttcctgagcccagagcagaccgaactctggggtggtcagggcagttctgtcctcttggaaacaggtcctggggactctactctagaggagcctgttggtagtagagttcctagcagcagcagaactgtgggctgcccgaagcagaaatctcataggcaggtacagctggaccaggaatgtgggcagggcctgaagctgaaaaaggacacttcccgcccctacgaatgttctgagtgtgagatcaccttccgctataagcagcagctggccacacatctgcgcagccactctgggtgggggtcttgtacacctgaggagccagaggagagccttaggcccaggccacggctgaaaccacagaccaaaaaggccaagctgcatcagtgtgatgtgtgcctgaggagcttcagctgcaaggtgagcctggtgacccatcagcgttgccacctgcaggaggggcccagtgccggccagcatgtccaagagaggttctcacccaacagcctggttgccctgcctggccacatcccttggaggaaaagccggagttccctcatctgtggttactgtggcaagagcttcagtcacccatctgacttggtgcggcaccagcgcatccacacgggtgagcggccctacagctgcactgagtgtgagaagagctttgtccagaagcagcacctcctgcagcaccagaagatccaccagcgggagcggggtgggctggccctggagcccggaaggcccaatggcctgctttaa
Sequence Length
1488
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
55,447 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 212, mRNA
NCBI Official Synonym Full Names
zinc finger protein 212
NCBI Official Symbol
ZNF212
NCBI Official Synonym Symbols
ZNF182; ZNFC150; C2H2-150
NCBI Protein Information
zinc finger protein 212
UniProt Protein Name
Zinc finger protein 212
Protein Family
UniProt Gene Name
ZNF212
UniProt Synonym Gene Names
ZNFC150
UniProt Entry Name
ZN212_HUMAN
NCBI Description
This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Uniprot Description
Zfp212: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 7q36.1
Cellular Component: nucleus
Molecular Function: identical protein binding; protein binding; transcription cofactor activity
Biological Process: regulation of transcription from RNA polymerase II promoter
Similar Products
Product Notes
The ZNF212 znf212 (Catalog #AAA1273388) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagt cggcgcctgc tcggcacagg agaaaacgac gctccacacc tttaacttct tccacacttc cttcacaagc aacagagaaa agctcctatt ttcagaccac cgagatttca ctctggacgg tggtggccgc tattcaggct gtggagaaga agatggagtc ccaggctgcc cggctacaga gcctggaggg gcgcacgggg acagccgaga agaagctggc tgactgcgag aagatggccg tggagttcgg gaaccagctg gagggcaagt gggccgtgct ggggaccctg ctgcaggagt atgggctact gcagaggcgg ctggagaacg tggagaacct gctgcgcaac aggaacttct ggatcctgcg gctgcccccg ggcagcaagg gggaggcccc caaggtgtcc aggtcactgg agaatgatgg cgtctgtttc accgagcagg aatgggagaa tctggaggat tggcagaagg agctctacag aaacgtgatg gagagtaact atgagacact ggtctctctg aaggtccttg gccagacaga gggagaagcg gagttgggta cagagatgct gggtgacttg gaagaggaag gtcctggtgg tgcccaccca gcaggtgggg tcatgatcaa acaggagcta cagtatacac aggaaggccc tgcggatctt cctggagagt tctcatgcat tgctgaagag caggctttcc tgagcccaga gcagaccgaa ctctggggtg gtcagggcag ttctgtcctc ttggaaacag gtcctgggga ctctactcta gaggagcctg ttggtagtag agttcctagc agcagcagaa ctgtgggctg cccgaagcag aaatctcata ggcaggtaca gctggaccag gaatgtgggc agggcctgaa gctgaaaaag gacacttccc gcccctacga atgttctgag tgtgagatca ccttccgcta taagcagcag ctggccacac atctgcgcag ccactctggg tgggggtctt gtacacctga ggagccagag gagagcctta ggcccaggcc acggctgaaa ccacagacca aaaaggccaa gctgcatcag tgtgatgtgt gcctgaggag cttcagctgc aaggtgagcc tggtgaccca tcagcgttgc cacctgcagg aggggcccag tgccggccag catgtccaag agaggttctc acccaacagc ctggttgccc tgcctggcca catcccttgg aggaaaagcc ggagttccct catctgtggt tactgtggca agagcttcag tcacccatct gacttggtgc ggcaccagcg catccacacg ggtgagcggc cctacagctg cactgagtgt gagaagagct ttgtccagaa gcagcacctc ctgcagcacc agaagatcca ccagcgggag cggggtgggc tggccctgga gcccggaagg cccaatggcc tgctttaa. It is sometimes possible for the material contained within the vial of "ZNF212, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
