ZNF175 cdna clone

ZNF175 cDNA Clone

Gene Names

ZNF175; OTK18

Synonyms

ZNF175; ZNF175 cDNA Clone; ZNF175 cdna clone

Ordering
Cat. Num. AAA1271343 For Research Use Only!

Sequence

atgcctgctgatgtgaatttatcccagaagcctcaggtcctgggtccagagaagcaggatggatcttgcgaggcatcagtgtcatttgaggacgtgaccgtggacttcagcagggaggagtggcagcaactggaccctgcccagagatgcctgtaccgggatgtgatgctggagctctatagccatctcttcgcagtggggtatcacattcccaacccagaggtcatcttcagaatgctaaaagaaaaggagccgcgtgtggaggaggctgaagtctcacatcagaggtgtcaagaaagggagtttgggcttgaaatcccacaaaaggagatttctaagaaagcttcatttcaaaaggatatggtaggtgagttcacaagagatggttcatggtgttccattttagaagaactgaggctggatgctgaccgcacaaagaaagatgagcaaaatcaaattcaacccatgagtcacagtgctttcttcaacaagaaaacattgaacacagaaagcaattgtgaatataaggaccctgggaaaatgattcgcacgaggccccaccttgcttcttcacagaaacaacctcagaaatgttgcttatttacagaaagtttgaagctgaacctagaagtgaacggtcagaatgaaagcaatgacacagaacagcttgatgacgttgttgggtctggtcagctattcagccatagctcttctgatgcctgcagcaagaatattcatacaggagagacattttgcaaaggtaaccagtgtagaaaagtctgtggccataaacagtcactcaagcaacatcaaattcatactcagaagaaaccagatggatgttctgaatgtggggggagcttcacccagaagtcacacctctttgcccaacagagaattcatagtgtaggaaacctccatgaatgtggcaaatgtggaaaagccttcatgccacaactaaaactcagtgtatatctgacagatcatacaggtgatataccctgtatatgcaaggaatgtgggaaggtctttattcagagatcagaattgcttacgcaccagaaaacacacactagaaagaagccctataaatgccatgactgtggaaaagcctttttccagatgttatctctcttcagacatcagagaactcacagtagagaaaaactctatgaatgcagtgaatgtggcaaaggcttctcccaaaactcaaccctcattatacatcagaaaattcatactggtgagagacagtatgcatgcagtgaatgtgggaaagcctttacccagaagtcaacactcagcttgcaccagagaatccactcagggcagaagtcctatgtgtgtatcgaatgcgggcaggccttcatccagaaggcacacctgattgtccatcaaagaagccacacaggagaaaaaccttatcagtgccacaactgtgggaaatccttcatttccaagtcacagcttgatatacatcatcgaattcatacaggggagaaaccttatgaatgcagtgactgtggaaaaaccttcacccaaaagtcacacctgaatatacaccagaaaattcatactggagaaagacaccatgtatgcagtgaatgcgggaaagccttcaaccagaagtcaatactcagcatgcatcagagaattcacaccggagagaagccttacaaatgcagtgaatgtgggaaagccttcacttctaagtctcaattcaaagagcatcagcgaattcacacgggtgagaaaccctatgtgtgcactgaatgtgggaaggccttcaacggcaggtcaaatttccataaacatcaaataactcacactagagagaggccttttgtctgttacaaatgtgggaaggcttttgtccagaaatcagagttgattacccatcaaagaactcacatgggagagaaaccctatgaatgccttgactgtgggaaatcgttcagtaagaaaccacaactcaaggtgcatcagcgaattcacacgggagaaagaccttatgtgtgttctgaatgtggaaaggccttcaacaacaggtcaaacttcaataaacaccaaacaactcataccagagacaaatcttacaaatgcagttattctgtgaaaggctttaccaagcaatga

Sequence Length

2136

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

31418338

NCBI GeneID

7728

Molecular Weight

81,609 Da

NCBI Official Full Name

Homo sapiens zinc finger protein 175, mRNA

NCBI Official Synonym Full Names

zinc finger protein 175

NCBI Official Symbol

ZNF175

NCBI Official Synonym Symbols

OTK18

NCBI Protein Information

zinc finger protein 175

UniProt Protein Name

Zinc finger protein 175

Protein Family

Zinc finger protein

UniProt Gene Name

ZNF175

UniProt Entry Name

ZN175_HUMAN

Uniprot Description

ZNF175: Down-regulates the expression of several chemokine receptors. Interferes with HIV-1 replication by suppressing Tat- induced viral LTR promoter activity. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein; DNA-binding

Chromosomal Location of Human Ortholog: 19q13.4

Cellular Component: cytoplasm; intermediate filament cytoskeleton; nucleoplasm

Molecular Function: protein binding; transcription factor activity

Research Articles on ZNF175

1. Clinical trial of gene-disease association and gene-environment interaction. (HuGE Navigator)

Similar Products

Product Notes

The ZNF175 znf175 (Catalog #AAA1271343) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctgctg atgtgaattt atcccagaag cctcaggtcc tgggtccaga gaagcaggat ggatcttgcg aggcatcagt gtcatttgag gacgtgaccg tggacttcag cagggaggag tggcagcaac tggaccctgc ccagagatgc ctgtaccggg atgtgatgct ggagctctat agccatctct tcgcagtggg gtatcacatt cccaacccag aggtcatctt cagaatgcta aaagaaaagg agccgcgtgt ggaggaggct gaagtctcac atcagaggtg tcaagaaagg gagtttgggc ttgaaatccc acaaaaggag atttctaaga aagcttcatt tcaaaaggat atggtaggtg agttcacaag agatggttca tggtgttcca ttttagaaga actgaggctg gatgctgacc gcacaaagaa agatgagcaa aatcaaattc aacccatgag tcacagtgct ttcttcaaca agaaaacatt gaacacagaa agcaattgtg aatataagga ccctgggaaa atgattcgca cgaggcccca ccttgcttct tcacagaaac aacctcagaa atgttgctta tttacagaaa gtttgaagct gaacctagaa gtgaacggtc agaatgaaag caatgacaca gaacagcttg atgacgttgt tgggtctggt cagctattca gccatagctc ttctgatgcc tgcagcaaga atattcatac aggagagaca ttttgcaaag gtaaccagtg tagaaaagtc tgtggccata aacagtcact caagcaacat caaattcata ctcagaagaa accagatgga tgttctgaat gtggggggag cttcacccag aagtcacacc tctttgccca acagagaatt catagtgtag gaaacctcca tgaatgtggc aaatgtggaa aagccttcat gccacaacta aaactcagtg tatatctgac agatcataca ggtgatatac cctgtatatg caaggaatgt gggaaggtct ttattcagag atcagaattg cttacgcacc agaaaacaca cactagaaag aagccctata aatgccatga ctgtggaaaa gcctttttcc agatgttatc tctcttcaga catcagagaa ctcacagtag agaaaaactc tatgaatgca gtgaatgtgg caaaggcttc tcccaaaact caaccctcat tatacatcag aaaattcata ctggtgagag acagtatgca tgcagtgaat gtgggaaagc ctttacccag aagtcaacac tcagcttgca ccagagaatc cactcagggc agaagtccta tgtgtgtatc gaatgcgggc aggccttcat ccagaaggca cacctgattg tccatcaaag aagccacaca ggagaaaaac cttatcagtg ccacaactgt gggaaatcct tcatttccaa gtcacagctt gatatacatc atcgaattca tacaggggag aaaccttatg aatgcagtga ctgtggaaaa accttcaccc aaaagtcaca cctgaatata caccagaaaa ttcatactgg agaaagacac catgtatgca gtgaatgcgg gaaagccttc aaccagaagt caatactcag catgcatcag agaattcaca ccggagagaa gccttacaaa tgcagtgaat gtgggaaagc cttcacttct aagtctcaat tcaaagagca tcagcgaatt cacacgggtg agaaacccta tgtgtgcact gaatgtggga aggccttcaa cggcaggtca aatttccata aacatcaaat aactcacact agagagaggc cttttgtctg ttacaaatgt gggaaggctt ttgtccagaa atcagagttg attacccatc aaagaactca catgggagag aaaccctatg aatgccttga ctgtgggaaa tcgttcagta agaaaccaca actcaaggtg catcagcgaa ttcacacggg agaaagacct tatgtgtgtt ctgaatgtgg aaaggccttc aacaacaggt caaacttcaa taaacaccaa acaactcata ccagagacaa atcttacaaa tgcagttatt ctgtgaaagg ctttaccaag caatga. It is sometimes possible for the material contained within the vial of "ZNF175, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

ZNF175 cdna clone