ZFYVE19 cdna clone
ZFYVE19 cDNA Clone
Gene Names
ZFYVE19; ANCHR; MPFYVE
Synonyms
ZFYVE19; ZFYVE19 cDNA Clone; ZFYVE19 cdna clone
Sequence
atggagagtaggtgctacggctgcgctgtcaagttcaccctcttcaagaaggagtacggctgtaagaattgtggcagggccttccgttcaggctgcctaagcttcagtgcagcagtgcctcggactgggaacacccaacagaaagtctgcaagcaatgccatgaggtcctgaccagagggtcttctgccaatgcctccaagtggtcaccacctcagaactataagaagcgtgtggcagccttggaagccaagcaaaagcccagcacttcccagagccagggactgacacgacaagaccagatgattgctgagcgcctagcacgactccgccaggagaacaagcccaagttagtcccctcacaggcagagatagaggcacggctggctgccctaaaggatgaacgtcagggttccatcccttccacccaggaaatggaggcacgacttgcagcgttgcagggcagagttctaccttctcaaaccccccagccggcacatcacacaccggacaccaggacccaagcccagcagacacaggatctgctaacgcagctggcagctgaggtggctatcgatgaaagctggaaaggaggaggcccagtgaccctccaggactatcgcctcccagacagtgatgacgacgaggatgaggagacagccatccaaagagtcctgcagcagctcactgaagaagctgccctggatgaggcaagtggctttaacatccctgcagagcaggcttctcgaccctggacgcaaccccgcggggcagagcctgaggcccaggatgtggaccccaggcctgaggctgaggaagaggagctcccctggtgctgcatctgcaatgaggatgccaccctacgctgcgctggctgcgatggggacctcttctgtgcccgctgcttccgagagggccatgatgcctttgagcttaaagagcaccagacatctgcctactctcctccacgtgcaggccaagagcactga
Sequence Length
987
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,963 Da
NCBI Official Full Name
Homo sapiens zinc finger, FYVE domain containing 19, mRNA
NCBI Official Synonym Full Names
zinc finger FYVE-type containing 19
NCBI Official Symbol
ZFYVE19
NCBI Official Synonym Symbols
ANCHR; MPFYVE
NCBI Protein Information
abscission/NoCut checkpoint regulator
UniProt Protein Name
Abscission/NoCut checkpoint regulator
Protein Family
UniProt Gene Name
ZFYVE19
UniProt Synonym Gene Names
ANCHR; MPFYVE; ANCHR
UniProt Entry Name
ANCHR_HUMAN
Uniprot Description
ZFYVE19: A chromosomal aberration involving ZFYVE19 is associated with acute myeloblastic leukemia (AML). Translocation t(11;15)(q23;q14) with MLL/HRX. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Oncoprotein
Chromosomal Location of Human Ortholog: 15q15.1
Cellular Component: centrosome; cleavage furrow; midbody
Molecular Function: phosphatidylinositol 3-phosphate binding; protein binding
Biological Process: abscission; negative regulation of cytokinesis
Research Articles on ZFYVE19
Similar Products
Product Notes
The ZFYVE19 zfyve19 (Catalog #AAA1270900) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagagta ggtgctacgg ctgcgctgtc aagttcaccc tcttcaagaa ggagtacggc tgtaagaatt gtggcagggc cttccgttca ggctgcctaa gcttcagtgc agcagtgcct cggactggga acacccaaca gaaagtctgc aagcaatgcc atgaggtcct gaccagaggg tcttctgcca atgcctccaa gtggtcacca cctcagaact ataagaagcg tgtggcagcc ttggaagcca agcaaaagcc cagcacttcc cagagccagg gactgacacg acaagaccag atgattgctg agcgcctagc acgactccgc caggagaaca agcccaagtt agtcccctca caggcagaga tagaggcacg gctggctgcc ctaaaggatg aacgtcaggg ttccatccct tccacccagg aaatggaggc acgacttgca gcgttgcagg gcagagttct accttctcaa accccccagc cggcacatca cacaccggac accaggaccc aagcccagca gacacaggat ctgctaacgc agctggcagc tgaggtggct atcgatgaaa gctggaaagg aggaggccca gtgaccctcc aggactatcg cctcccagac agtgatgacg acgaggatga ggagacagcc atccaaagag tcctgcagca gctcactgaa gaagctgccc tggatgaggc aagtggcttt aacatccctg cagagcaggc ttctcgaccc tggacgcaac cccgcggggc agagcctgag gcccaggatg tggaccccag gcctgaggct gaggaagagg agctcccctg gtgctgcatc tgcaatgagg atgccaccct acgctgcgct ggctgcgatg gggacctctt ctgtgcccgc tgcttccgag agggccatga tgcctttgag cttaaagagc accagacatc tgcctactct cctccacgtg caggccaaga gcactga. It is sometimes possible for the material contained within the vial of "ZFYVE19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
