Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZFP64 cdna clone

ZFP64 cDNA Clone

Gene Names
ZFP64; ZNF338
Synonyms
ZFP64; ZFP64 cDNA Clone; ZFP64 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacgcgagcagcgagggcgagagcttcgcgggctcggtgcaaattccaggtggcacaacggtgctggtggagctgactcccgacatccatatctgcggcatctgcaagcagcagtttaacaacctggatgcctttgtagctcacaagcaaagtggctgccagctgacaggcacatccgcagcagcccccagcacggtccagtttgtatcggaggaaacagtgcctgccacccagactcagaccaccaccagaaccatcacctcggagacccagacaatcacagtttcagctccagaatttgtttttgaacatggctatcaaacttacctgcccacggaaagtaatgaaaaccagacagccactgtcatctctctccctgccaagtcacgcaccaaaaagcccacaacaccacctgctcagaaaaggcttaactgttgctatccaggttgccaattcaagactgcttatggcatgaaggacatggagcggcatttaaaaattcacacgggagacaaaccccataagtgtgaagtctgtggcaagtgctttagccggaaagacaagctgaaaactcacatgcggtgccacacgggcgtgaagccctacaagtgtaagacgtgtgactacgccgctgccgacagcagcagcctcaacaagcacctgaggatccactcggacgagcggcccttcaaatgccagatctgcccctacgccagccgcaactccagccagctcactgtccacctgcgatcccacacggcttcagaacttgatgatgatgttccaaaagcaaactgcctctccactgaaagcactgacactccgaaggcccctgtcatcactcttccctcagaggcaagggaacaaatggccacccttggagagaggacgttcaactgttgctacccaggttgccacttcaaaactgtccatggcatgaaagacttggaccgccatctcagaatccacacgggagacaaaccgcacaagtgtgagttctgtgacaagtgcttcagccggaaggacaacctgaccatgcacatgcggtgccacaccagtgtgaagccacacaagtgtcacctgtgtgactacgctgccgtggacagcagtagcctcaagaagcacctgcggatccactctgatgagcggccgtacaaatgccagctctgcccctatgccagccgcaactccagccagctcaccgtccacctgcgatctcacacgggggatacccccttccagtgctggctctgtagcgccaagttcaaaatcagctcggacttgaaaaggcacatgatcgtgcactcgggggagaagcctttcaagtgcgagttctgcgacgtccgctgcaccatgaaggcgaatctcaaatcgcacatccgcatcaagcacaccttcaaatgtctgcactgtgccttccagggccgggaccgggctgacctcctggagcacagccggctgcaccaggccgaccacccggagaagtgtccagagtgcagctactcctgctccagcgcggccgccctgcgcgtgcacagcagagtccactgtaaggactgtcccttcaagtgtgacttctgcagcttcgacacgaagcggcccagcagcctggccaagcacgtcgacaaggtgcacagggacgaggccaagacggagaaccgggcccctctgggcaaggaagggctcagagagggcagctcccagcacgtggccaagatcgtgacgcagagggccttccgctgtgagacctgcggcgcctccttcgtcagggatgactctctgagatgccacaagaagcagcacagtgatcagagtgagaacaagaactcagacttggtcaccttcccaccggaaagcggtgcctcgggacagctcagcaccctggtctccgtggggcagctcgaggctcccctagagcccagccaagacctctag
Sequence Length
1938
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,463 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 64 homolog (mouse), mRNA
NCBI Official Synonym Full Names
ZFP64 zinc finger protein
NCBI Official Symbol
ZFP64
NCBI Official Synonym Symbols
ZNF338
NCBI Protein Information
zinc finger protein 64
UniProt Protein Name
Zinc finger protein 64 homolog, isoforms 3 and 4
Protein Family
UniProt Gene Name
ZFP64
UniProt Synonym Gene Names
ZNF338; Zfp-64
UniProt Entry Name
ZF64B_HUMAN

Uniprot Description

ZFP64 iso3: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein; Transcription regulation; DNA-binding

Chromosomal Location of Human Ortholog: 20q13.2

Molecular Function: protein binding

Research Articles on ZFP64

Similar Products

Product Notes

The ZFP64 zfp64 (Catalog #AAA1274395) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacgcga gcagcgaggg cgagagcttc gcgggctcgg tgcaaattcc aggtggcaca acggtgctgg tggagctgac tcccgacatc catatctgcg gcatctgcaa gcagcagttt aacaacctgg atgcctttgt agctcacaag caaagtggct gccagctgac aggcacatcc gcagcagccc ccagcacggt ccagtttgta tcggaggaaa cagtgcctgc cacccagact cagaccacca ccagaaccat cacctcggag acccagacaa tcacagtttc agctccagaa tttgtttttg aacatggcta tcaaacttac ctgcccacgg aaagtaatga aaaccagaca gccactgtca tctctctccc tgccaagtca cgcaccaaaa agcccacaac accacctgct cagaaaaggc ttaactgttg ctatccaggt tgccaattca agactgctta tggcatgaag gacatggagc ggcatttaaa aattcacacg ggagacaaac cccataagtg tgaagtctgt ggcaagtgct ttagccggaa agacaagctg aaaactcaca tgcggtgcca cacgggcgtg aagccctaca agtgtaagac gtgtgactac gccgctgccg acagcagcag cctcaacaag cacctgagga tccactcgga cgagcggccc ttcaaatgcc agatctgccc ctacgccagc cgcaactcca gccagctcac tgtccacctg cgatcccaca cggcttcaga acttgatgat gatgttccaa aagcaaactg cctctccact gaaagcactg acactccgaa ggcccctgtc atcactcttc cctcagaggc aagggaacaa atggccaccc ttggagagag gacgttcaac tgttgctacc caggttgcca cttcaaaact gtccatggca tgaaagactt ggaccgccat ctcagaatcc acacgggaga caaaccgcac aagtgtgagt tctgtgacaa gtgcttcagc cggaaggaca acctgaccat gcacatgcgg tgccacacca gtgtgaagcc acacaagtgt cacctgtgtg actacgctgc cgtggacagc agtagcctca agaagcacct gcggatccac tctgatgagc ggccgtacaa atgccagctc tgcccctatg ccagccgcaa ctccagccag ctcaccgtcc acctgcgatc tcacacgggg gataccccct tccagtgctg gctctgtagc gccaagttca aaatcagctc ggacttgaaa aggcacatga tcgtgcactc gggggagaag cctttcaagt gcgagttctg cgacgtccgc tgcaccatga aggcgaatct caaatcgcac atccgcatca agcacacctt caaatgtctg cactgtgcct tccagggccg ggaccgggct gacctcctgg agcacagccg gctgcaccag gccgaccacc cggagaagtg tccagagtgc agctactcct gctccagcgc ggccgccctg cgcgtgcaca gcagagtcca ctgtaaggac tgtcccttca agtgtgactt ctgcagcttc gacacgaagc ggcccagcag cctggccaag cacgtcgaca aggtgcacag ggacgaggcc aagacggaga accgggcccc tctgggcaag gaagggctca gagagggcag ctcccagcac gtggccaaga tcgtgacgca gagggccttc cgctgtgaga cctgcggcgc ctccttcgtc agggatgact ctctgagatg ccacaagaag cagcacagtg atcagagtga gaacaagaac tcagacttgg tcaccttccc accggaaagc ggtgcctcgg gacagctcag caccctggtc tccgtggggc agctcgaggc tcccctagag cccagccaag acctctag. It is sometimes possible for the material contained within the vial of "ZFP64, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.