ZFAND5 cdna clone
ZFAND5 cDNA Clone
Gene Names
ZFAND5; ZA20D2; ZNF216; ZFAND5A
Synonyms
ZFAND5; ZFAND5 cDNA Clone; ZFAND5 cdna clone
Sequence
atggctcaggagactaaccagaccccggggcccatgctgtgtagcacaggatgtggcttttatggaaatcctaggacaaatggaatgtgttcagtttgctacaaagaacatcttcagaggcagcaaaatagtggcagaatgagcccaatggggacagctagtggttccaacagtcctacctcagattctgcatctgtacagagagcagacactagcttaaacaactgtgaaggtgctgctggcagcacatctgaaaaatcaagaaatgtgcctgtggctgccttgcctgtaactcagcaaatgacagaaatgagcatttcaagagaggacaaaataactaccccgaaaacagaggtgtcagagccagttgtcactcagcccagtccatcagtttctcagcccagtacttctcagagtgaagaaaaagctcctgaattgcccaaaccaaagaaaaacagatgtttcatgtgcagaaagaaagttggtcttacagggtttgactgccgatgtggaaatttgttttgtggacttcaccgttactctgacaagcacaactgtccgtatgattacaaagcagaagctgcagcaaaaatcagaaaagagaatccagttgttgtggctgaaaaaattcagagaatataa
Sequence Length
642
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,132 Da
NCBI Official Full Name
Homo sapiens zinc finger, AN1-type domain 5, mRNA
NCBI Official Synonym Full Names
zinc finger AN1-type containing 5
NCBI Official Symbol
ZFAND5
NCBI Official Synonym Symbols
ZA20D2; ZNF216; ZFAND5A
NCBI Protein Information
AN1-type zinc finger protein 5
UniProt Protein Name
AN1-type zinc finger protein 5
Protein Family
UniProt Gene Name
ZFAND5
UniProt Synonym Gene Names
ZA20D2; ZNF216
UniProt Entry Name
ZFAN5_HUMAN
Uniprot Description
ZA20D2: Involved in protein degradation via the ubiquitin- proteasome system. May act by anchoring ubiquitinated proteins to the proteasome. Plays a role in ubiquitin-mediated protein degradation during muscle atrophy. Plays a role in the regulation of NF-kappa-B activation and apoptosis. Inhibits NF-kappa-B activation triggered by overexpression of RIPK1 and TRAF6 but not of RELA. Inhibits also tumor necrosis factor (TNF), IL-1 and TLR4- induced NF-kappa-B activation in a dose-dependent manner. Overexpression sensitizes cells to TNF-induced apoptosis. Is a potent inhibitory factor for osteoclast differentiation.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 9q13-q21
Molecular Function: protein binding
Research Articles on ZFAND5
1. Zfand5 can enhance ARE-containing mRNA stability by competing with tristetraprolin for mRNA binding.
Similar Products
Product Notes
The ZFAND5 zfand5 (Catalog #AAA1273566) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcagg agactaacca gaccccgggg cccatgctgt gtagcacagg atgtggcttt tatggaaatc ctaggacaaa tggaatgtgt tcagtttgct acaaagaaca tcttcagagg cagcaaaata gtggcagaat gagcccaatg gggacagcta gtggttccaa cagtcctacc tcagattctg catctgtaca gagagcagac actagcttaa acaactgtga aggtgctgct ggcagcacat ctgaaaaatc aagaaatgtg cctgtggctg ccttgcctgt aactcagcaa atgacagaaa tgagcatttc aagagaggac aaaataacta ccccgaaaac agaggtgtca gagccagttg tcactcagcc cagtccatca gtttctcagc ccagtacttc tcagagtgaa gaaaaagctc ctgaattgcc caaaccaaag aaaaacagat gtttcatgtg cagaaagaaa gttggtctta cagggtttga ctgccgatgt ggaaatttgt tttgtggact tcaccgttac tctgacaagc acaactgtcc gtatgattac aaagcagaag ctgcagcaaa aatcagaaaa gagaatccag ttgttgtggc tgaaaaaatt cagagaatat aa. It is sometimes possible for the material contained within the vial of "ZFAND5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
